View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_low_7 (Length: 440)
Name: NF6808_low_7
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 419; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 1 - 423
Target Start/End: Complemental strand, 30138540 - 30138118
Alignment:
| Q |
1 |
catgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccacagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138540 |
catgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccacagg |
30138441 |
T |
|
| Q |
101 |
cattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138440 |
cattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaagt |
30138341 |
T |
|
| Q |
201 |
tcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138340 |
tcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttttg |
30138241 |
T |
|
| Q |
301 |
gttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacccgatgatcgtaattatttcaccctttggattgtttcaatcttcag |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138240 |
gttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacctgatgatcgtaattatttcaccctttggattgtttcaatcttcag |
30138141 |
T |
|
| Q |
401 |
tggcttaatttggttagttggtg |
423 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30138140 |
tggcttaatttggttagttggtg |
30138118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University