View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6809_high_10 (Length: 268)
Name: NF6809_high_10
Description: NF6809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6809_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 52 - 266
Target Start/End: Complemental strand, 11073940 - 11073726
Alignment:
| Q |
52 |
tgaatgtggatgtcaggtgttttaaggacgaaactgttggttggggcatggtgcttagagaccacagaggagtagttgaatttgttgcaacaaaactgga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11073940 |
tgaatgtggatgtcaggtgttttaaggatgaaactgttggttggggcatggtgcttagagaccacagaggagtagttgaatttgttgcaacaaaactgga |
11073841 |
T |
|
| Q |
152 |
aagaaggtatatatgatataccatgatatatcccctaacctggttgaagctctatctcttcgttggtgtcttcaatggatcctaacaacaaaccgagagg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11073840 |
aagaaggtatatatgatataccatgatatatcccctaacctgtttgaagctctatctcttcgttggtgtcttcaatggatcctaacaacaaaccgagagg |
11073741 |
T |
|
| Q |
252 |
ctaatttactcattg |
266 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11073740 |
ctaatttactcattg |
11073726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 46
Target Start/End: Complemental strand, 11074276 - 11074243
Alignment:
| Q |
13 |
gaacagggtgaacaagaaagggatgcacattgat |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11074276 |
gaacagggtgaacaagaaagggatgcacattgat |
11074243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University