View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6809_high_13 (Length: 229)
Name: NF6809_high_13
Description: NF6809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6809_high_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 76 - 229
Target Start/End: Complemental strand, 29195754 - 29195601
Alignment:
| Q |
76 |
gtgtaataccctaactgctagcttccttccaggtctaatggttagctacgctagactcggtctagagaacgtcaaacctcgtttgatggcttaatgagtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195754 |
gtgtaataccctaactgctagcttcctcccacgtctaatggttagctacgctagactcggtctagagaacgtcaaacctcgtttgatggcttaatgagtc |
29195655 |
T |
 |
| Q |
176 |
atagtggctattattcccaaacatacatggtgaataccgcaagaggggtttctt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195654 |
atagtggctattattcccaaacatacatggtgaataccgcaagaggggtttctt |
29195601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 24666266 - 24666320
Alignment:
| Q |
48 |
tattcgagtgatttccacttctctggaagtgtaataccctaactgctagcttcct |
102 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||| |||||||| ||||| |
|
|
| T |
24666266 |
tattcgagtgagttccacttctcttgaagcgtaatacccttactgctagtttcct |
24666320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 12363652 - 12363706
Alignment:
| Q |
48 |
tattcgagtgatttccacttctctggaagtgtaataccctaactgctagcttcct |
102 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||| |||||||| ||||| |
|
|
| T |
12363652 |
tattcgagtgagttccacttctcttgaagcgtaatacccttactgctagtttcct |
12363706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University