View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6809_low_13 (Length: 244)
Name: NF6809_low_13
Description: NF6809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6809_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 11074723 - 11074506
Alignment:
| Q |
24 |
tgaacaagcctccaaaaacaattattttggattctaaaatccgaatagagcgcgagaacctcgtaaaaagtaatggccaattttttataaccggattttg |
123 |
Q |
| |
|
||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11074723 |
tgaacaagcctccaaaaacaagtatttcgcattctaaaatccgaatagagcgcgagaacctcgtaaaaagtaatggccaattttttataaccggattttg |
11074624 |
T |
 |
| Q |
124 |
tcagatatttgatatccacctctaggtagatccatgatcgtgtaaaaaacagtctagtcaataatgcagacaataatttcaatgcag-ataacaataacg |
222 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||| ||| | |||| ||||||||||| |||||||||||| |
|
|
| T |
11074623 |
tcagatatttgatatccacccctaggtggatccgtgatcgtgtaaaaaacagtctagtca--aatcc--ttaatactttcaatgcagaataacaataacg |
11074528 |
T |
 |
| Q |
223 |
atgaagccagacaaatccttaa |
244 |
Q |
| |
|
||||||| || ||||||||||| |
|
|
| T |
11074527 |
atgaagctaggcaaatccttaa |
11074506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University