View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6809_low_19 (Length: 220)
Name: NF6809_low_19
Description: NF6809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6809_low_19 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 4 - 220
Target Start/End: Original strand, 29195393 - 29195609
Alignment:
| Q |
4 |
aattagaaggccatgtctaatatcacaaaaaataaggataggtctaaatttgagtttgagttattatannnnnnnccctcatatgtccactccattaaag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29195393 |
aattagaaggccatgtctaatatcacaaaaaataaggattggtctaaatttgagtttgagttattatattttttcccctcatatgtccactccattaaag |
29195492 |
T |
 |
| Q |
104 |
ataatcatatattcaagctgttgtgcattaaacgtgagtatctctctcaactagggttacttacaatcacttgtagcttgttttctttctataaactcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29195493 |
ataatcatatattcaagctgttgtgcattaaacgtgagtatctctctcaactagggttacttacaatcacttgtagcttgttttctttctataaactcta |
29195592 |
T |
 |
| Q |
204 |
agtctcataagaaaccc |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29195593 |
agtctcataagaaaccc |
29195609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University