View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6809_low_8 (Length: 340)
Name: NF6809_low_8
Description: NF6809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6809_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 144 - 320
Target Start/End: Complemental strand, 25177300 - 25177125
Alignment:
| Q |
144 |
ggtgttatgaatcttttactattgcactagatgatttttacaattcaaacttgtgatgacatcataatcatgcaacagtaaatttgatctttattacacc |
243 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25177300 |
ggtgttatgaatcttttaccattgcactagatgatttttacaattcaaacttgtgatgacatcataatcatgcaacagtaaatttgatctttattacacc |
25177201 |
T |
 |
| Q |
244 |
ataagtctctttcaattgtgtaaaagtagccatggtggcatattcaannnnnnnccccatttcatgcatatacgtgc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
25177200 |
ataagtctctttcaattgtgtaaaagtagccatggtggcatatt-aatttttttccccatttcatgcatatacgtgc |
25177125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University