View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6812_high_12 (Length: 277)

Name: NF6812_high_12
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6812_high_12
NF6812_high_12
[»] chr2 (2 HSPs)
chr2 (16-117)||(1254727-1254828)
chr2 (185-269)||(1254566-1254650)


Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 16 - 117
Target Start/End: Complemental strand, 1254828 - 1254727
Alignment:
16 ataagagcatgtgtaaacttactaaatataaaagatagatatttccatactctaataataatgtattgcaatatcttttaatgaatttaaaactgagtta 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1254828 ataagagcatgtgtaaacttactaaatataaaagatagatatttccatactctaataataatgtattgcaatatcttttaatgaatttaaaactgagtta 1254729  T
116 tg 117  Q
    ||    
1254728 tg 1254727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 185 - 269
Target Start/End: Complemental strand, 1254650 - 1254566
Alignment:
185 gtgtaaacagtgtagtaggatagacgtaatgagatgaattgatccataataacaggtcatgatctatgtggtgttcctatctcat 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1254650 gtgtaaacagtgtagtaggatagacgtaatgagatgaattgatccataataacaggtcatgatctatgtggtgttcctatctcat 1254566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University