View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_high_19 (Length: 229)
Name: NF6812_high_19
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_high_19 |
 |  |
|
| [»] scaffold0911 (2 HSPs) |
 |  |  |
|
| [»] scaffold0196 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0911 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: scaffold0911
Description:
Target: scaffold0911; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 2743 - 2574
Alignment:
| Q |
1 |
aacatccgaggtatcagtaaatttgtatctaaaattgccttgaggaatatatctctgtctcataaaccattttttatggcagaactgaagatttg----- |
95 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
2743 |
aacatctgaggtatcggtaaatttgtatctaaaattgccttgagaaatttatctctgtctcataaaccattttttatggcggaaccgaagatttgttttg |
2644 |
T |
 |
| Q |
96 |
----------ttcttggtattggaatagcattggattttcgaaacattgcttgaatgatagagctgccaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
2643 |
aaagtgttccttcttggtattggaatagcattggattttcgaaatattgcttgaatgttagagctgccaa |
2574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0911; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 180 - 229
Target Start/End: Complemental strand, 2520 - 2471
Alignment:
| Q |
180 |
gttacgagttcagtttggttggatacgctccttacggagttacgtcttga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
2520 |
gttacgagttcagtttggttggatacgctcctgacggagttacgccttga |
2471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 346 - 442
Alignment:
| Q |
1 |
aacatccgaggtatcagtaaatttgtatctaaaattgccttgaggaatatatctctgtctcataaaccattttttatggcagaactgaagatttgtt |
97 |
Q |
| |
|
||||||| |||||| |||| |||| |||||||||| ||||||| ||| ||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
346 |
aacatccaaggtataggtaattttgaatctaaaatttccttgagaaatttatctctgtctcataaaccattttttatggcggaaccgaagatttgtt |
442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 162 - 229
Target Start/End: Original strand, 567 - 633
Alignment:
| Q |
162 |
gcgaatatggggcatgttgttacgagttcagtttggttggatacgctccttacggagttacgtcttga |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| | |||| ||||||||||| ||||| |
|
|
| T |
567 |
gcgaatatggggcatgttgttacgggttcagtttggttggat-cactcccgacggagttacgccttga |
633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 162
Target Start/End: Original strand, 456 - 520
Alignment:
| Q |
96 |
ttcttggtattggaatagcattggattttcgaaacattgcttgaatgatagagctgccaaatttatg |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||| || ||| | ||||||||||||| |
|
|
| T |
456 |
ttcttggtattggaatagcattggaatttcgaaatatt--ttgagtgttagtgttgccaaatttatg |
520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University