View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_high_7 (Length: 310)
Name: NF6812_high_7
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_high_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 155 - 310
Target Start/End: Original strand, 37443764 - 37443919
Alignment:
| Q |
155 |
attcaataatcattttgggtgcagaacataccaatattattttgagagcagatagtgtaaacaatttctatgtggctgcaaatgcatcacgattatggag |
254 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37443764 |
attcaataatcattttgggtacagaacataccaatattattttgagaggagatagtgtgaacaatttctatgtggctgcaaatgcatcacgattatggag |
37443863 |
T |
 |
| Q |
255 |
aattctccataactcgaaagaacacacgacgtttgataacgaagaaagactaattt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37443864 |
aattctccataactcgaaagaacacacgacgtttgataacgaagaaagaccaattt |
37443919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 50 - 163
Target Start/End: Original strand, 37443492 - 37443601
Alignment:
| Q |
50 |
tagtgttgctgctttttaccttttacaagtaaatataatagggataaggttgttttcgtttagaggcttcctttttaccctctttaccctcataaggagg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37443492 |
tagtgttgctgctttttaccttttacaagtaaatataatagggataa---tgttttcgtttagaggcttcctttttaccctcttta-cctcataaggagg |
37443587 |
T |
 |
| Q |
150 |
atacaattcaataa |
163 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37443588 |
atacaattcaataa |
37443601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University