View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_low_15 (Length: 277)
Name: NF6812_low_15
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 16 - 117
Target Start/End: Complemental strand, 1254828 - 1254727
Alignment:
| Q |
16 |
ataagagcatgtgtaaacttactaaatataaaagatagatatttccatactctaataataatgtattgcaatatcttttaatgaatttaaaactgagtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1254828 |
ataagagcatgtgtaaacttactaaatataaaagatagatatttccatactctaataataatgtattgcaatatcttttaatgaatttaaaactgagtta |
1254729 |
T |
 |
| Q |
116 |
tg |
117 |
Q |
| |
|
|| |
|
|
| T |
1254728 |
tg |
1254727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 185 - 269
Target Start/End: Complemental strand, 1254650 - 1254566
Alignment:
| Q |
185 |
gtgtaaacagtgtagtaggatagacgtaatgagatgaattgatccataataacaggtcatgatctatgtggtgttcctatctcat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1254650 |
gtgtaaacagtgtagtaggatagacgtaatgagatgaattgatccataataacaggtcatgatctatgtggtgttcctatctcat |
1254566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University