View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_low_18 (Length: 244)
Name: NF6812_low_18
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 11550107 - 11550340
Alignment:
| Q |
1 |
tttcttttgggtgttctacctatatatgacgccctttaatttgttatttctttggtaacacgtaaatgagttttctttgattttcacccttaacatgact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
11550107 |
tttcttttgggtgttctacctatatatgacgcactttaatttcttgtttctttggtaacacgtaaacgagttttctttgattttcacccttcacatgact |
11550206 |
T |
|
| Q |
101 |
catgtctaggggatgtgaactggtatatttgaataaagatcaaactaagcatttaaacaacgacaccacataataacacacgtaggcacattgaaacctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| || ||||||| |||| ||| |
|
|
| T |
11550207 |
catgtctaggggatgtgaactggtatatttgaataaagatccaactaagcatttaaacaacgacaccgcataataacacatgtgggcacatcgaaatctc |
11550306 |
T |
|
| Q |
201 |
agcctaaaaccaagggttaaagtgcttgatgtcc |
234 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |
|
|
| T |
11550307 |
agcctaaaaccaaaggttaaagtgctcgatgtcc |
11550340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University