View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_low_19 (Length: 242)
Name: NF6812_low_19
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 42860858 - 42860649
Alignment:
| Q |
12 |
attaactagttcatttttatttcactttcagattaatttagtgtgcatcgctcacaagtcattatatttcgatatgtatttatgaacaatcgctaatact |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42860858 |
attaactagttcatttctatttcactttcagattaatattgtgtgcatcgctcacaagtcattatatttcgatatgtatttatgaacaatcgctaatact |
42860759 |
T |
 |
| Q |
112 |
aatatttgatgataggaacaattttataaaattgttatacttattcatttctttattgattgtgacctatgtgaatataactttaaatggcatgtatttt |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42860758 |
aatatttgat---aggaacaattttataaaattgttatacttattcatttctttattgattgtgacctatgtgaatataactttaaatggcatgtatttt |
42860662 |
T |
 |
| Q |
212 |
ataacggatatat |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42860661 |
ataacggatatat |
42860649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University