View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6812_low_24 (Length: 220)
Name: NF6812_low_24
Description: NF6812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6812_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 71 - 199
Target Start/End: Complemental strand, 25742871 - 25742743
Alignment:
| Q |
71 |
tgaacattttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgac |
170 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25742871 |
tgaacatgttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgac |
25742772 |
T |
 |
| Q |
171 |
aattcacaacaagaaaaagacatactaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25742771 |
aattcacaacaagaaaaagacatactaga |
25742743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University