View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6814_high_3 (Length: 339)
Name: NF6814_high_3
Description: NF6814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6814_high_3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 77 - 339
Target Start/End: Original strand, 20132376 - 20132638
Alignment:
| Q |
77 |
cgaattgtgttgcgtatgtgatgtcaaaaaccttacatgaaaagtttttgaaatatcacttttctgcattgcatattgctacaatgatgatataaaacgt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
20132376 |
cgaattgtgttgcgtatgtgatgtcaaaaaccttacatgaaaagtttttgaaatatcacttttctgcattgcatattactacaaagatgatataaaacgt |
20132475 |
T |
|
| Q |
177 |
aatgatatattttgaagtttacggtgttccaaacactttgtttctcttttgtatttgattttatcttcattcaagtagtgaagttgtatttcatgcaaaa |
276 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20132476 |
aatgatatattttgaagtttagggtgtcccaaacactttgtatctcttttgtctttgattttatcttaattcaagtagtgaagttgtatttcatgcaaaa |
20132575 |
T |
|
| Q |
277 |
tatataatgtggttttacttttatgttgtgttannnnnnnggattttcaagtatgagaaattt |
339 |
Q |
| |
|
|||||||||||||| ||| |||||| || | || ||||||||||| ||||||||||| |
|
|
| T |
20132576 |
tatataatgtggttgtacgtttatgatgagataatattttggattttcaagcatgagaaattt |
20132638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 271
Target Start/End: Original strand, 35815161 - 35815201
Alignment:
| Q |
231 |
ttgattttatcttcattcaagtagtgaagttgtatttcatg |
271 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
35815161 |
ttgattttgtctttattcaagtagtgaagttgtatttcatg |
35815201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University