View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6814_low_7 (Length: 307)
Name: NF6814_low_7
Description: NF6814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6814_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 4 - 290
Target Start/End: Original strand, 11073437 - 11073723
Alignment:
| Q |
4 |
tgagttggtcatgctcctttttcttttcttctggttatggaattgttaagttatactattgggtttcaagttgatgctagtatacaacttatgtagttag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11073437 |
tgagttggtcatgctcctttttcttttcttctggttatggaattgttaagttatactattgggtttcaagttgatgctagtatgcaacttatgtagttag |
11073536 |
T |
|
| Q |
104 |
gaaggaagggttaaatttgttgaaagttggtgttatagaaagttggtggtggaggaggagtctggtggggaaaggattagattgtaggaggaaatttttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11073537 |
gaaggaagggttaaatttgttgaaagttggtgttatagaaagttggtggtggaggaggagtctggtggggaaaggataagattgtaggaggaaatctttt |
11073636 |
T |
|
| Q |
204 |
aagcggtagttactctttaagacagactaaccataggaggtacctcacttcatgcaatgataaactagattacaattcactttgatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11073637 |
aagcggtagttactctttaagacagactaaccataggaggtacctcacttcatgcaatgataaactagattacaattcacttcgatg |
11073723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University