View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_high_16 (Length: 229)
Name: NF6815_high_16
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 52 - 216
Target Start/End: Complemental strand, 37050982 - 37050807
Alignment:
| Q |
52 |
gtaattgaatcattgaatgtaataacatatgtcatcgtgttgttagacatcggctttcaat-------------gctacatacttttgtgtaatgaatga |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37050982 |
gtaattgaatcattgaatgtaataacatatgtcatcgtgttgttagacatcggctttcaatccaaagtgtcgatgctacatacttttgtgtaatgaatga |
37050883 |
T |
 |
| Q |
139 |
tgaatatgatttgaaggagtagccatgtgtgatgatgcaaactaggcatgagttgatgtgattttctgtgttttatgt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37050882 |
tgaatatgatttgaaggagtagcca--tgtgatgatgcaaactaggcatgagttgatgtgattttctgtgttttatgt |
37050807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University