View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_high_3 (Length: 465)
Name: NF6815_high_3
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 46 - 444
Target Start/End: Original strand, 48251478 - 48251881
Alignment:
| Q |
46 |
aaacaattaatgtaattacactcaacg-----gtgttgtgtcggacaccaaacacataagtgttggtgctaatcttctctttggcagcattgatgtcttt |
140 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251478 |
aaacaattaatgtaattacactcatcggtgttgtgttgtgtcggacaccaaacacataagtgtcggtgctaatcttctctttggcagcattgatgtcttt |
48251577 |
T |
|
| Q |
141 |
tacagctttactaacaaagtagaagtaatactatccatttgtcattatcagtgggatgcgcttgaaaacaagtccacagtgcttctatatggtggtggag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251578 |
tacagctttactaacaaagtagaagtaatactaaccatttgtcattatcagtgggatgcgcttgaaaacaagtccacagtgcttctatatggtggtggag |
48251677 |
T |
|
| Q |
241 |
gtttagttgctgtttggttatcttcaattctcgttggtgccatcaactcagtccccttggtaagccatatcactcttgcttttttaagttcccttattag |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251678 |
gtttagttgctgtttggttatcttcaattctcgttggtgccatcaactcagtccccttggtaagccatatcactcttgcttttttaagttcccttattag |
48251777 |
T |
|
| Q |
341 |
gcgttttgaaccaatctgaaacaattctattttcggtttcagcttccaaagattatggagttggtaggactagggtacaccggatggtttgtgtaccgat |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251778 |
gcgttttgaaccaatctgaaacaattctattttcggtttcagcttccaaagattatggagttggtaggactagggtacaccggatggtttgtgtaccgat |
48251877 |
T |
|
| Q |
441 |
acct |
444 |
Q |
| |
|
|||| |
|
|
| T |
48251878 |
acct |
48251881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University