View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_high_5 (Length: 419)
Name: NF6815_high_5
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 5 - 402
Target Start/End: Complemental strand, 40369313 - 40368916
Alignment:
| Q |
5 |
cactgtttttgtgttatccaccactggagaaagtgctatgatcaatgcccttttcacttgttgatgtgttgcttgtcttggggttgcaccaagagccaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369313 |
cactgtttttgtgttatccaccactggagaaagtgctatgatcaatgcccttttcacttgttgatgtgttgcttgtcttggggttgcaccaagagccaat |
40369214 |
T |
|
| Q |
105 |
gccgtctcaacctggcataaattcatatgatgtagaaattaattaaatctactatagttctatttattagtacaattttcaaacaaatactatcgtcgaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369213 |
gccgtctcaacctggcataaattcatatgatatagaaattaattaaatctactatatttctatttattagtacaattttcaaacaaatactatcgtcgaa |
40369114 |
T |
|
| Q |
205 |
atcataatgagttgggacgctgaaggaggttcgtgttagatgacataccaagttcatttgtgctttgatgtcgtctcggagtcttttcatggtaactccg |
304 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40369113 |
atcataatgatttgggacgctgaaggaggttcgtgttagatgacataccaagttcatttgtgctttgatgtcgtctctgagtcttttcatggtaactccg |
40369014 |
T |
|
| Q |
305 |
gtaacggtcatcgagtttccaaccatcatgcctgcaacagggatgatatatctgggagtgaaagggaagacgctgagtgccactagaacaaacatagt |
402 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369013 |
gtaacggtcattgagtttccaaccatcatgcctgcaacagggatgatatatctgggagtgaaagggaagacgctgagtgccactagaacaaacatagt |
40368916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University