View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_low_11 (Length: 307)
Name: NF6815_low_11
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 4 - 290
Target Start/End: Original strand, 33900332 - 33900617
Alignment:
| Q |
4 |
ggtgttgattttagattcagcaattgatcttgtactttaatttgagatgccttgatatggaataaaggacaaatgaatttataattggtttgttcagatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900332 |
ggtgttgattttagattcagcaattgatcttgtactttaatttgagatgccttgatatggaataaaggacaaatgaatttataattggtttgttcagatt |
33900431 |
T |
 |
| Q |
104 |
aaatacatgaaaatcagttgatgagggggaaaacttgcttaccatttttatgtgagttttaaaatatgtacggaactatgatgtgtggtaaagctttgcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900432 |
aaatacatgaaaatcagttgatgagggggaaaacttgcttaccatttttatgtgagttttgaaatatgtacggaactatgatgtgtggtaaagctttgca |
33900531 |
T |
 |
| Q |
204 |
cgttgtccactttgctacaaccttctacttcctcgtctctttactttcaatcaaattaaagaaaatgatagttataagtaagtattt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33900532 |
cgttgtccactttgctacaaccttctacttcctcgtctctttactttcaatcaaattaaag-aaatgatagttataagtaagtattt |
33900617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University