View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_low_12 (Length: 271)
Name: NF6815_low_12
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_low_12 |
 | |
|
| [»] scaffold0088 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0088 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 48425 - 48687
Alignment:
| Q |
1 |
atcggaccttaaattcgaatctataatgttttgttaaactttaagagatatcttaccctttgattcaaattttattgaatatttaaagattacgattatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48425 |
atcggaccttaaattcgaatctata-tgttttgttaaactttaagagatatcttaccctttgattcaaattttattgaatatttaaagattacgattatt |
48523 |
T |
|
| Q |
101 |
tgtcaatgtaaaaaattgtcaaaagattacgattatttgttaatgcattaatttaattatgcagcctacattgcgtcccttagttttgggatgtgatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48524 |
tgtcaatgtaaaaaattgtcaaaagattacgattatttgttaatgcattaatttaattatgcagcctacattgcgtcccttagttttgggatgtgatcaa |
48623 |
T |
|
| Q |
201 |
cttgtatcattatctgttcttgaagctatatttgagaagcttgccggtcctgttgatattcttc |
264 |
Q |
| |
|
||||||||||||||| || | |||||| |||| |||||||||||||||||||| |||||| |
|
|
| T |
48624 |
tccgtatcattatctgttgttagaactatatatgagcagcttgccggtcctgttgatgttcttc |
48687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University