View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_low_13 (Length: 263)
Name: NF6815_low_13
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 21209495 - 21209363
Alignment:
| Q |
17 |
gaagtttatgaagaaatgaaagcgacgggatgtaaaccgaatatttgtacctttaatgctcttatcaagatgcatggtaatcgtggaatgtttgtggaaa |
116 |
Q |
| |
|
|||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21209495 |
gaagtttacgacgaaatgaaagcggcgggatgcaaaccgaatatttgtacctttaatgctcttatcaagatgcatggtaatcgtgggatgtttgtggaaa |
21209396 |
T |
|
| Q |
117 |
taatgatagtttttgacgatattaaggaatgtg |
149 |
Q |
| |
|
| |||| ||||||||| || ||||||||||||| |
|
|
| T |
21209395 |
tgatgaaagtttttgaggagattaaggaatgtg |
21209363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 145 - 246
Target Start/End: Complemental strand, 42218143 - 42218039
Alignment:
| Q |
145 |
atgtgagaaattaaacgtgggatgggaccatgtggtcattgtttgaattcaaaggccgtgtgtgtgaggg---aagatagggatgcaatttaggaatctt |
241 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42218143 |
atgtgaggaattgaacatgggatgggaccatgtggtcattgtttgaattcaaaggctgtgtgtgtgagggagaaagatagggatgcaatttaggaatctt |
42218044 |
T |
|
| Q |
242 |
agttt |
246 |
Q |
| |
|
||||| |
|
|
| T |
42218043 |
agttt |
42218039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University