View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_low_16 (Length: 230)
Name: NF6815_low_16
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 49133315 - 49133128
Alignment:
| Q |
1 |
aaaattgttcaccaactttggatcaagtaaagtaatggatagacacacagctaaatctggtgaagaacaatgataaaatgttacagaacatgttctattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133315 |
aaaattgttcaccaactttggatcaagtaaagtaatggatagacacacagctaaatctggtgaagaacaatgataaaatgttacagaacatgttctattt |
49133216 |
T |
|
| Q |
101 |
cttcgacaggataacatattcttataaatcaagcaattcgaccatcaacattctcaggcatgcctcttccttcatgatgaccaccatc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49133215 |
cttcgacaggataacatattcttataaatcaagcaattcgaccatcaatattctcaggcatgccttttccttcatgatgaccaccatc |
49133128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University