View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6815_low_18 (Length: 229)
Name: NF6815_low_18
Description: NF6815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6815_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 130
Target Start/End: Complemental strand, 35698099 - 35697974
Alignment:
| Q |
7 |
agacggacactaagtcatcgttgtatgaaacagtggagttggaaaaacttcattgatgaatcaaaatgtgcagaagaagtttagtctgcaacacaaag-- |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35698099 |
agacggacactaagtcatcgttgtatgaaacagtggagttggaaaaacttcattgatgaatcaaaatgtgcagaagaagtttagtctgcaatacaaagct |
35698000 |
T |
|
| Q |
105 |
ctaccattggtgtgagttttatcact |
130 |
Q |
| |
|
|||| |||||||||| |||||||||| |
|
|
| T |
35697999 |
ctacaattggtgtgaattttatcact |
35697974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 126 - 229
Target Start/End: Complemental strand, 35697897 - 35697794
Alignment:
| Q |
126 |
tcactcttttatgctgagttaaaattcattggtgttaaacattttacatgtcttcttgattttatcttcaagcactcgaacacttttttagcaatattac |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| | |||| | ||||||||||||| |
|
|
| T |
35697897 |
tcactcttttatgcagagttaaaattcactggtgttagacattttacatgtcttcttgattttatctgcaagcactcaatcactatgttagcaatattac |
35697798 |
T |
|
| Q |
226 |
tttt |
229 |
Q |
| |
|
|||| |
|
|
| T |
35697797 |
tttt |
35697794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University