View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6817_high_10 (Length: 285)
Name: NF6817_high_10
Description: NF6817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6817_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 48596038 - 48595783
Alignment:
| Q |
19 |
cttcaaaatttaggagaagccctttctcgttggtagaagaatccaaagggaagtacttctctgcgtgttgctttggaatcacaagtcgattcagtttccc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48596038 |
cttcaaaatttaggagaagccctttctcgttggtagaagaatccaaagggaagtacttctctgcgtgttgctttggaatcacaagtcgatttagtttccc |
48595939 |
T |
 |
| Q |
119 |
tacgtcactaggtgtcaccactttgtcaaacatatgctctttctctactactgctactactactgcctcttcctcatcctttgaatttgaacaacatcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48595938 |
tacgtcactaggtgtcaccactttgtcaaacatatgctctttctctac---------tactactgcctcttcctcatcctttgaatttgaacaacatcct |
48595848 |
T |
 |
| Q |
219 |
attcctaatccttcatcacttcccttgctcttgctaattccccctcctccaagtcttaactccat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48595847 |
attcctaatccttcatcacttcccttgctcttgctaattccccctcctccaagtcttaactccat |
48595783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University