View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6817_low_24 (Length: 217)

Name: NF6817_low_24
Description: NF6817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6817_low_24
NF6817_low_24
[»] chr1 (1 HSPs)
chr1 (17-183)||(37426671-37426839)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 37426839 - 37426671
Alignment:
17 gtgttatgctgtgtgcatctcttccccaatgggtgaaccaggtgttgtcaaatatgaacatagacacatgggaaattagttgccagttgtttgtagatgg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
37426839 gtgttatgctgtgtgcatctcttccccaatgggtgaaccaggtgttgtcaaatatgaacatagacacatgggaaattagttgccggttgtttgtagatgg 37426740  T
117 --ttgaggttctgattagctgattttgtgtcaagaatttgttatatttcattttggatttgattgtaca 183  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37426739 ttttgaggttctgattagctgattttgtgtcaagaatttgttatatttcattttggatttgattgtaca 37426671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University