View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_high_14 (Length: 389)
Name: NF6819A_high_14
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 7 - 383
Target Start/End: Original strand, 10119532 - 10119912
Alignment:
| Q |
7 |
attaattacatcaatgttttaaaaatcggataagacatcaaacaagcaaaacttctgaatcatggttcatggttcatggttcaactgccttaaattgctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119532 |
attaattacatcaatgttttaaaaatcggataagacatcaaacaagcaaaacttctgaatcatggttcatggttcatggttcaactgccttaaattgctt |
10119631 |
T |
|
| Q |
107 |
gaacccgaacgaaactggtattgaaccgctaaaataaccaaaccgtcagtttaaggtacaaccgattgaaccgtcctgttgggtttttgaaacactgaac |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119632 |
gaacccgaacgaaactgggattgaaccgctaaa-taaccaaaccgtcagtttaaggtacaaccgattgaaccgtcctgttgggtttttgaaacactgaac |
10119730 |
T |
|
| Q |
207 |
aagataacatcactgaaaataatgaatgaatcatgaaatgaaaatatagggacggttataacatggttgagtgtttgatattttacattgctttaaag-- |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119731 |
aagataacatcactgaaaataatgaatgaatcatgcaatgaaaatatagggacggttataacatggttgagtgtttgatattttacattgctttaaagat |
10119830 |
T |
|
| Q |
305 |
--atataacggtttaatagaaatatggcgctttgc-gttccttttgcttgtaccaaaagcaacactccttctctctttgttt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119831 |
atatataacggtttaatagaaatatggcgctttgcggttccttttgcttgtaccaaaagcaacactccttctctctttgttt |
10119912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University