View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_high_20 (Length: 348)
Name: NF6819A_high_20
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 20 - 341
Target Start/End: Original strand, 470811 - 471138
Alignment:
| Q |
20 |
catcaattcttccaccccttttcagtattaatctttttcaactcttttctttcacaaaatgtctccaagttttgatttttccaactggggttgggttaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
470811 |
catcaattcttccaccccttttcagtattaatctttttcaactcttttctttcacaaaatgtctccaagttttgatttttccaactggggttgggttaaa |
470910 |
T |
 |
| Q |
120 |
aattcttca------acttcaacttcaaagaaaggtggtaaccctgttgttgttactatgggaaatccaaattactcagtccttcaaataaatggtcctg |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
470911 |
aattcttcaaattcaacttcaacttcaaagaaaggtggtaaccctgttgttgttactatgggaaatccaaattactcagtgcttcaaataaatggtcctg |
471010 |
T |
 |
| Q |
214 |
attcagcatttcaaccagttgagaaagatagaaccagaaatgctaaacaattcacatgggttttacttctcaaagctcataaagctattggtttcattgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471011 |
attcagcatttcaaccagttgagaaagatagaaccagaaatgctaaacaattcacatgggttttacttctcaaagctcataaagctattggtttcattgc |
471110 |
T |
 |
| Q |
314 |
ttggtttggaaattgtgtttgttcattg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
471111 |
ttggtttggaaattgtgtttgttcattg |
471138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University