View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_high_36 (Length: 254)

Name: NF6819A_high_36
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_high_36
NF6819A_high_36
[»] chr1 (1 HSPs)
chr1 (9-249)||(28675596-28675836)
[»] chr7 (1 HSPs)
chr7 (139-178)||(40638109-40638148)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 28675596 - 28675836
Alignment:
9 aacaatatggcaacaaaagagagtatgtgggacccaccaaaaacggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtg 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28675596 aacaaaatggcaacaaaagagagtatgtgggacccaccaaaaagggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtg 28675695  T
109 gtgggttgtttggaggagcgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttcc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28675696 gtgggttgtttggaggagcgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttcc 28675795  T
209 ttaggattaagaacatagagttagactttgatcttgttctt 249  Q
    |||||||||||||||||||||||||||||||||||||||||    
28675796 ttaggattaagaacatagagttagactttgatcttgttctt 28675836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 139 - 178
Target Start/End: Complemental strand, 40638148 - 40638109
Alignment:
139 acttgacccatgcaagtgactttaggggaagaaggttctt 178  Q
    ||||||||||||||||||||||||||||||||||||||||    
40638148 acttgacccatgcaagtgactttaggggaagaaggttctt 40638109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University