View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_115 (Length: 262)
Name: NF6819A_low_115
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_115 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 30590484 - 30590224
Alignment:
| Q |
1 |
atacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggtatttgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590484 |
atacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggtatttgtct |
30590385 |
T |
|
| Q |
101 |
ggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaatgtcaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30590384 |
ggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaatgtcagat |
30590285 |
T |
|
| Q |
201 |
tgcttgatcagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatga |
262 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590284 |
tgcttgatcagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatga |
30590224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University