View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_132 (Length: 254)
Name: NF6819A_low_132
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_132 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 43669522 - 43669759
Alignment:
| Q |
12 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatacgtgactgttccattaagaaatttaaatggactgatcttaatcgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43669522 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatatgtgactgttccattaagaaatttaaatggattgatcttaatcgg |
43669621 |
T |
|
| Q |
112 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcnnnnnnnnnnnnncacattataatgattgcatatttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43669622 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcaaaaatgaaaaaacacattataatgattgcatatttat |
43669721 |
T |
|
| Q |
212 |
ggttaagcattgcatgatgatttagtactatcatattt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669722 |
ggttaagcattgcatgatgatttagtactatcatattt |
43669759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University