View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_136 (Length: 251)
Name: NF6819A_low_136
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_136 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 26930054 - 26929872
Alignment:
| Q |
41 |
gtcttttttgaatgtgaaaattaaaagttattttggggggtgggaaaagtttttgtccatgaccttaacgaagctcgcatacgttagcccaagtcatttg |
140 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26930054 |
gtcttttttgaatgtgaaaattcaaagttattttggggggtgggaaaagtttttgtccatgaccttaacgaagctcgcataagttagcccaagtcatttg |
26929955 |
T |
 |
| Q |
141 |
ttgttattttctctcttcgatacttatccgccgttttctggagtgtttctcgcaaatcaatcgtttgtaagcgaatcttcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26929954 |
ttgttattttctctcttcgatacttatccgccgttttctggagtgtttctcgcaaatcaatcgcctgtaagccaatcttcatt |
26929872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 44 - 142
Target Start/End: Original strand, 17197498 - 17197596
Alignment:
| Q |
44 |
ttttttgaatgtgaaaattaaaagttattttggggggtgggaaaagtttttgtccatgaccttaacgaagctcgcatacgttagcccaagtcatttgtt |
142 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||| ||||||||||||||||||| |||||| |||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
17197498 |
ttttttgaatgtgtaaattcaaagtgattttgtggggtgggaaaagtttttgcccatgatcttaactaagctcacataagttagcccaagtcatttgtt |
17197596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 33454905 - 33454869
Alignment:
| Q |
10 |
tactaacgaaaagacggacactcactttcccgtcttt |
46 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
33454905 |
tactagcgaaaagacggacactcacttgcccgtcttt |
33454869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University