View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_137 (Length: 251)

Name: NF6819A_low_137
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_137
NF6819A_low_137
[»] chr4 (1 HSPs)
chr4 (39-226)||(1831657-1831845)
[»] chr5 (1 HSPs)
chr5 (94-223)||(30065210-30065339)
[»] chr3 (1 HSPs)
chr3 (123-226)||(9816970-9817073)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 39 - 226
Target Start/End: Complemental strand, 1831845 - 1831657
Alignment:
39 agggtcaactagctccttatcttcattctttacacacctaaggt-cacttcagatggtgtagatgcaggattgaagcccatcatgttgaatctctttaaa 137  Q
    ||||||||||||||| | ||||||||||||||||  | |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1831845 agggtcaactagctcttcatcttcattctttacaagcttaagattcacttcagatggtgtagatgcaggattgaagcccatcatgttgaatctctttaaa 1831746  T
138 atatttgtagcatatttcttctggtgcaccactcaaccttatgaagttttagtgaattccatcccaaggaaatattttaactttcccaa 226  Q
    |||||||||||||||||||||||||||| |||| ||| || ||||||||||||||||||||| ||| |||||||| |||||||||||||    
1831745 atatttgtagcatatttcttctggtgcatcactaaacattctgaagttttagtgaattccattccagggaaatatgttaactttcccaa 1831657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 30065339 - 30065210
Alignment:
94 gtgtagatgcaggattgaagcccatcatgttgaatctctttaaaatatttgtagcatatttcttctggtgcaccactcaaccttatgaagttttagtgaa 193  Q
    ||||||||||||||||| ||  || ||||||||| ||||| | |||||  | |||||| |||||||| |||   |||  |||||  ||||||||||||||    
30065339 gtgtagatgcaggattgcagttcaacatgttgaacctcttgagaatatcagaagcatacttcttctgatgcttaactagaccttcagaagttttagtgaa 30065240  T
194 ttccatcccaaggaaatattttaactttcc 223  Q
    |||||| |||||||| ||| ||||||||||    
30065239 ttccataccaaggaagtatgttaactttcc 30065210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 226
Target Start/End: Complemental strand, 9817073 - 9816970
Alignment:
123 ttgaatctctttaaaatatttgtagcatatttcttctggtgcaccactcaaccttatgaagttttagtgaattccatcccaaggaaatattttaactttc 222  Q
    ||||||||||| ||||||| | | ||||||||||||| ||||| |||| | || | ||| |||||||||||||| || |||| ||||||| ||||| |||    
9817073 ttgaatctcttcaaaatatctattgcatatttcttctagtgcatcactaatccctttgaggttttagtgaattctattccaaagaaatatgttaaccttc 9816974  T
223 ccaa 226  Q
    ||||    
9816973 ccaa 9816970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University