View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_150 (Length: 249)

Name: NF6819A_low_150
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_150
NF6819A_low_150
[»] chr2 (14 HSPs)
chr2 (15-249)||(45726296-45726527)
chr2 (18-116)||(39284516-39284615)
chr2 (15-117)||(35447548-35447650)
chr2 (15-117)||(17863811-17863913)
chr2 (82-125)||(1632370-1632413)
chr2 (15-94)||(14698547-14698626)
chr2 (15-116)||(10706768-10706869)
chr2 (15-116)||(23077987-23078088)
chr2 (15-63)||(29867552-29867600)
chr2 (15-63)||(34389331-34389379)
chr2 (15-59)||(2837291-2837335)
chr2 (15-63)||(6595442-6595490)
chr2 (15-94)||(17865658-17865737)
chr2 (15-63)||(36988523-36988571)
[»] chr3 (24 HSPs)
chr3 (30-152)||(31340723-31340845)
chr3 (15-157)||(46173095-46173237)
chr3 (15-118)||(29812680-29812784)
chr3 (82-158)||(34490592-34490668)
chr3 (18-116)||(51398445-51398544)
chr3 (15-157)||(54593065-54593207)
chr3 (15-117)||(4569352-4569454)
chr3 (33-118)||(29810485-29810571)
chr3 (15-128)||(44331176-44331290)
chr3 (18-117)||(36018262-36018362)
chr3 (18-116)||(21711685-21711783)
chr3 (15-94)||(6096265-6096345)
chr3 (82-122)||(30235614-30235654)
chr3 (34-117)||(55302648-55302731)
chr3 (15-116)||(49200116-49200218)
chr3 (81-122)||(47303761-47303802)
chr3 (15-116)||(39032060-39032161)
chr3 (15-116)||(27038522-27038623)
chr3 (15-116)||(35925971-35926072)
chr3 (15-116)||(40735048-40735148)
chr3 (15-94)||(1735832-1735910)
chr3 (15-63)||(7764124-7764172)
chr3 (15-90)||(8127110-8127186)
chr3 (60-92)||(40845180-40845212)
[»] chr4 (18 HSPs)
chr4 (15-157)||(26363626-26363768)
chr4 (15-144)||(54882413-54882543)
chr4 (15-119)||(9927908-9928012)
chr4 (15-119)||(12745864-12745967)
chr4 (30-119)||(12740001-12740089)
chr4 (30-119)||(12748207-12748295)
chr4 (81-157)||(50263418-50263494)
chr4 (15-116)||(6655357-6655459)
chr4 (34-116)||(18377838-18377920)
chr4 (81-158)||(50674577-50674654)
chr4 (15-93)||(16628411-16628488)
chr4 (15-119)||(3754630-3754733)
chr4 (82-122)||(8653109-8653149)
chr4 (82-122)||(8664916-8664956)
chr4 (15-63)||(52095808-52095856)
chr4 (15-94)||(3778029-3778108)
chr4 (80-118)||(34570917-34570955)
chr4 (102-150)||(24968696-24968745)
[»] chr6 (3 HSPs)
chr6 (15-126)||(21593058-21593169)
chr6 (81-116)||(33160847-33160882)
chr6 (15-64)||(9183457-9183506)
[»] chr7 (22 HSPs)
chr7 (33-144)||(34311285-34311396)
chr7 (15-157)||(2389653-2389795)
chr7 (15-118)||(47674390-47674494)
chr7 (15-118)||(47676583-47676687)
chr7 (15-117)||(14070281-14070383)
chr7 (15-117)||(14380309-14380411)
chr7 (19-119)||(4585778-4585878)
chr7 (30-116)||(27347543-27347630)
chr7 (18-94)||(32358504-32358580)
chr7 (85-128)||(48491207-48491250)
chr7 (31-112)||(18126268-18126349)
chr7 (15-116)||(26416933-26417034)
chr7 (15-158)||(6570170-6570314)
chr7 (15-63)||(23554712-23554760)
chr7 (15-94)||(33331987-33332067)
chr7 (120-158)||(4513066-4513104)
chr7 (82-128)||(48489039-48489084)
chr7 (15-89)||(49092172-49092245)
chr7 (70-158)||(4509323-4509412)
chr7 (70-158)||(4511165-4511254)
chr7 (70-158)||(6431424-6431513)
chr7 (15-59)||(6360577-6360621)
[»] chr5 (13 HSPs)
chr5 (15-158)||(40146627-40146770)
chr5 (15-115)||(42428865-42428966)
chr5 (15-119)||(32636441-32636544)
chr5 (18-115)||(42426685-42426783)
chr5 (15-94)||(212986-213065)
chr5 (18-117)||(5057450-5057549)
chr5 (15-117)||(37438764-37438866)
chr5 (15-116)||(12083693-12083794)
chr5 (15-119)||(16651069-16651174)
chr5 (102-150)||(42310463-42310512)
chr5 (15-94)||(11916509-11916588)
chr5 (102-147)||(42926502-42926548)
chr5 (101-130)||(212969-212998)
[»] chr8 (15 HSPs)
chr8 (15-116)||(15212405-15212507)
chr8 (30-118)||(33351788-33351877)
chr8 (15-117)||(11383405-11383509)
chr8 (15-94)||(22975958-22976037)
chr8 (30-128)||(4731266-4731364)
chr8 (15-127)||(4733434-4733546)
chr8 (15-73)||(30143005-30143063)
chr8 (81-158)||(40220132-40220209)
chr8 (15-94)||(42435656-42435736)
chr8 (60-134)||(3051626-3051700)
chr8 (15-73)||(43036086-43036144)
chr8 (15-63)||(12703086-12703134)
chr8 (15-59)||(27810975-27811019)
chr8 (15-63)||(31217929-31217977)
chr8 (15-63)||(42497887-42497935)
[»] chr1 (7 HSPs)
chr1 (31-144)||(192985-193099)
chr1 (15-116)||(28220674-28220776)
chr1 (33-119)||(30476892-30476978)
chr1 (15-116)||(28223869-28223971)
chr1 (82-126)||(42298593-42298637)
chr1 (102-157)||(29135698-29135753)
chr1 (15-116)||(44454779-44454880)
[»] scaffold0466 (1 HSPs)
scaffold0466 (33-117)||(6749-6833)
[»] scaffold0014 (1 HSPs)
scaffold0014 (15-117)||(80948-81050)
[»] scaffold0286 (1 HSPs)
scaffold0286 (15-116)||(10959-11061)
[»] scaffold0066 (1 HSPs)
scaffold0066 (15-115)||(20862-20963)
[»] scaffold0176 (1 HSPs)
scaffold0176 (15-71)||(17711-17767)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 249
Target Start/End: Complemental strand, 45726527 - 45726296
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
45726527 atcgtgtcacatttgcccaaaatcgtgtcacaattggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgt 45726428  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaacaacaacaattagtaacatgtctattataactaatacataccttgtgttgtgctgcaag 214  Q
    ||||||||||||||||||||||||||| |||||| ||||||||   ||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
45726427 ttcttcactttctcaaaatccatttttcagtcacctctcaaca---acaattagtaacatgtctattataaataatacataccttgtgttgtgctgcaag 45726331  T
215 tgcttctctgaatgcagtattgtacatgtccatcg 249  Q
    |||||||||| | ||||||||||||||||||||||    
45726330 tgcttctctgcacgcagtattgtacatgtccatcg 45726296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 39284615 - 39284516
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctga-aaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    ||||||| ||| |||||||||||||||| |  ||||||||||  ||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||    
39284615 gtgtcacgttttcccaaaatcgtgtcacgataggacaccctgcgaaaccatgctcactgcctagaaaatcgtgacacgtttgccaattcgtgtcacgatt 39284516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 35447548 - 35447650
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||||||| ||||||||||||| |||| || ||||||||||||  ||||||||||||||||||||| ||||||| ||||  |||| ||||| ||    
35447548 atcgtgtcacattttcccaaaatcgtgttacaattgaacaccctgaaaacaatgctcactgcctagaaaatcatgacacgcttgcgtaatcatgtcatga 35447647  T
115 ttc 117  Q
    |||    
35447648 ttc 35447650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 117
Target Start/End: Complemental strand, 17863913 - 17863811
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| ||||||||  |||||| | ||||||||||||||| |||||||||||||| ||||||||||  ||| |  | ||||||||||||||    
17863913 atcgtgtcacgttttcccaaaattatgtcacgattggacaccctgaaaaccatgctcactgccttgaaaatcgtgcgacgatgccaaaatcgtgtcacga 17863814  T
115 ttc 117  Q
    |||    
17863813 ttc 17863811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 82 - 125
Target Start/End: Original strand, 1632370 - 1632413
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcacttt 125  Q
    |||||||||||||||||||||| |||||||||||||||||||||    
1632370 aaatcgtgacacggttgccaaaacgtgtcacgattcttcacttt 1632413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 14698626 - 14698547
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| ||||||||||||  || |||| ||| || ||||||||||||||||||||||||||| ||| ||||    
14698626 atcgtgtcacgttttcccaaaatcgtgatacgaatgaacatccagaaaatcatgctcactgcctagaaaattgtgtcacg 14698547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 10706869 - 10706768
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctga-aaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||| ||||| ||  |||||||| ||| ||||||| |||||| ||||||||||||||| |    |||||||||||||    
10706869 atcgtgtcacgttttcccaaaatcgtgacacaattgagcaccctgagaaaccatgctccctgcct-gaaaatcgtgacacgttgatgaaatcgtgtcacg 10706771  T
114 att 116  Q
    |||    
10706770 att 10706768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 23078088 - 23077987
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||||||| ||||| ||  ||||||  ||  |||||||||||||| | ||||||||||||| |    ||||||||||||||    
23078088 atcgtgtcacgttttcccaaaatcgtgacacaattgagcaccctacaatccatgctcactgcctgggaaatcgtgacacgttgatgaaatcgtgtcacga 23077989  T
115 tt 116  Q
    ||    
23077988 tt 23077987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 29867600 - 29867552
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | |||||||||||||||    
29867600 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgaaaa 29867552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 34389331 - 34389379
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | |||||||||||||||    
34389331 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgaaaa 34389379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 2837291 - 2837335
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg 59  Q
    |||||||||| ||| |||||||||||||||| | |||||||||||    
2837291 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctg 2837335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 6595442 - 6595490
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||| ||||||| | |||||||||||||||    
6595442 atcgtgtcacgttttcccaaaattgtgtcacgattggacaccctgaaaa 6595490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 17865658 - 17865737
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccct-gaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||||||| |||||||||||| ||  | ||  ||||||  |||| |||||||||||||| |||||||||||||||    
17865658 atcgtgtcacattttcccaaaatcgtgacatgattgagcaccctaaaaaaccatgctcactgcct-gaaaatcgtgacacg 17865737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 36988523 - 36988571
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| ||||||||| |||||| | |||||||||||||||    
36988523 atcgtgtcacgttttcccaaaatcatgtcacgattggacaccctgaaaa 36988571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 24)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 30 - 152
Target Start/End: Original strand, 31340723 - 31340845
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctca 129  Q
    ||||||||| |||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31340723 cccaaaatcatgtcacgattggacaccctgaaaaccatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctca 31340822  T
130 aaatccatttttgagtcacatct 152  Q
    |||||||||||||||||||||||    
31340823 aaatccatttttgagtcacatct 31340845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 46173237 - 46173095
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||  ||| |||||||||||||||| | ||||||||||| ||| |||||||||||||| | ||||||||||| | ||||||| || ||||||||    
46173237 atcgtgtcatgttttcccaaaatcgtgtcacgattggacaccctgcaaaccatgctcactgccttggaaatcgtgacatgtttgccaattcatgtcacga 46173138  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
46173137 ttcttcactttctcaaaatccatttttgagccacatctcaaca 46173095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 118
Target Start/End: Complemental strand, 29812784 - 29812680
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| |||| |||||||||||||||||||||||||||||  |||| |||||||||||||    
29812784 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcactgcctagaaaatcgtgacacacttgctaaatcgtgtcacg 29812685  T
114 attct 118  Q
    |||||    
29812684 attct 29812680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 82 - 158
Target Start/End: Complemental strand, 34490668 - 34490592
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||  | |||||||||| |||||||||||||    
34490668 aaatcgtgacacggttgccaaatcgtgtcatgattcttcactttctcaattttcatttttgagccacatctcaacaa 34490592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 51398544 - 51398445
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    ||||||| ||| |||||||||||||||||| ||||||||||| |||| |||||||||| ||||||||||||||||||| ||  |||||||||| ||||||    
51398544 gtgtcacgttttcccaaaatcgtgtcacaattggacaccctgcaaaaccatgctcactacctagaaaatcgtgacacgcttagcaaatcgtgttacgatt 51398445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 54593207 - 54593065
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||| | ||||| | || | ||| |||||| ||||||||||||||||||||||||| || ||||   ||||||| ||| ||    
54593207 atcgtgtcacgttttcccaaaattgagtcacgattgaataccatgaaaaccatgctcactgcctagaaaatcgtgccatggttcataaatcgtatcatga 54593108  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    ||||  ||||| || ||| ||||||||||||||||||||||||    
54593107 ttctgaactttttccaaaaccatttttgagtcacatctcaaca 54593065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 117
Target Start/End: Complemental strand, 4569454 - 4569352
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| ||||||||| |||||| | |||||||||| |||| ||||| ||||||||||||||| ||| |||| |  | ||||||||||||||    
4569454 atcgtgtcacgttttcccaaaatcatgtcacgattggacaccctaaaaaccatgcgcactgcctagaaaattgtgccacgatgccaaaatcgtgtcacga 4569355  T
115 ttc 117  Q
    |||    
4569354 ttc 4569352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 33 - 118
Target Start/End: Complemental strand, 29810571 - 29810485
Alignment:
33 aaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattct 118  Q
    ||||||||||||| | ||||||||||| |||| |||||||| |||||||||||| |||||||| |||| ||||| ||||||||||||    
29810571 aaaatcgtgtcacgattggacaccctgcaaaaccatgctcaatgcctagaaaattgtgacacgcttgctaaatcatgtcacgattct 29810485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 128
Target Start/End: Complemental strand, 44331290 - 44331176
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctaga-aaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | || |||||| | ||| ||| |||||  | | |  |||||||||||||||||||||| |||||||||    
44331290 atcgtgtcactttttcccaaaatcgtgtcacgattgaacacccagcaaaacatactcacaacattgcgaaatcgtgacacggttgccaaagcgtgtcacg 44331191  T
114 attcttcactttctc 128  Q
    |||||||||||||||    
44331190 attcttcactttctc 44331176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 36018362 - 36018262
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatc-atgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    ||||||| ||| |||||||||||||||| | ||  ||||| |||||   ||||||||||||||||||||||||||||| ||||  |||||||||||||||    
36018362 gtgtcacgttttcccaaaatcgtgtcacgattgagcacccagaaaaaatatgctcactgcctagaaaatcgtgacacgcttgcgtaatcgtgtcacgatt 36018263  T
117 c 117  Q
    |    
36018262 c 36018262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 116
Target Start/End: Original strand, 21711685 - 21711783
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    ||||||| ||| |||||||||||| ||| | ||  ||||||||||| |||||||||||||| ||||||||||||||| |    ||||||||||||||||    
21711685 gtgtcacgttttcccaaaatcgtgacacgattgagcaccctgaaaaccatgctcactgcctggaaaatcgtgacacgttgaagaaatcgtgtcacgatt 21711783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 6096265 - 6096345
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaa-tcgtgacacg 94  Q
    |||||||||| ||| |||||||||||||||||| ||||||||||| ||| |||||||| |||||  |||| ||||||||||    
6096265 atcgtgtcacgttttcccaaaatcgtgtcacaattggacaccctgcaaaccatgctcagtgccttcaaaattcgtgacacg 6096345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 30235654 - 30235614
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcac 122  Q
    |||||||||||||||||||||||||||||||||||||||||    
30235654 aaatcgtgacacggttgccaaatcgtgtcacgattcttcac 30235614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 55302648 - 55302731
Alignment:
34 aaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattc 117  Q
    |||||||||||| | || ||||||||||||  |||||||||||||||||||||||| |||  |  | |||||||||||||||||    
55302648 aaatcgtgtcacgattgaacaccctgaaaacaatgctcactgcctagaaaatcgtgccacaatgccaaaatcgtgtcacgattc 55302731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 49200116 - 49200218
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| ||||| |||||||||| | ||||||||||| ||| ||||||||| || | | ||||||||||||||  ||  |||||||||||||    
49200116 atcgtgtcacgtttccccaacatcgtgtcacgattggacaccctgcaaaacatgctcacggcattgcaaaatcgtgacacgcctgtaaaatcgtgtcacg 49200215  T
114 att 116  Q
    |||    
49200216 att 49200218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 47303802 - 47303761
Alignment:
81 aaaatcgtgacacggttgccaaatcgtgtcacgattcttcac 122  Q
    ||||||||| ||||||||||||||||||||||||||||||||    
47303802 aaaatcgtgtcacggttgccaaatcgtgtcacgattcttcac 47303761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 39032161 - 39032060
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctga-aaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||||||| |||||||||||| ||| | ||  |||||||| ||| ||||||| |||||| ||||||||||||||| |    |||||||||||||    
39032161 atcgtgtcacattttcccaaaatcgtgacacgattgagcaccctgagaaaccatgctccctgcct-gaaaatcgtgacacgttgatgaaatcgtgtcacg 39032063  T
114 att 116  Q
    |||    
39032062 att 39032060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 27038522 - 27038623
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||||||| |||||||||||| ||  | ||  ||||||| ||| |||||||||||||| | |||||||| |||| |    ||||||||||||||    
27038522 atcgtgtcacattttcccaaaatcgtgacatgattgagcaccctgcaaaccatgctcactgcctgggaaatcgtgtcacgttgatgaaatcgtgtcacga 27038621  T
115 tt 116  Q
    ||    
27038622 tt 27038623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 35925971 - 35926072
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| | |||| ||||| ||| | ||  ||||||| ||| |||||||||||||| | ||||||||||||| |    ||||||||||||||    
35925971 atcgtgtcacgttttctcaaactcgtgacacgattgagcaccctgcaaaccatgctcactgcctgggaaatcgtgacacgttgatgaaatcgtgtcacga 35926070  T
115 tt 116  Q
    ||    
35926071 tt 35926072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 40735148 - 40735048
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||||||| ||| | ||  ||||||| ||| ||||||||||| || | ||||||||||||| |    ||||||||||||||    
40735148 atcgtgtcacgttttcccaaaatcgtgacacgattgagcaccctgcaaaccatgctcactg-cttggaaatcgtgacacgttgatgaaatcgtgtcacga 40735050  T
115 tt 116  Q
    ||    
40735049 tt 40735048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 1735910 - 1735832
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa-tcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||| ||| | ||  |||||||||||  |||||||||||||| |||||||||||||||    
1735910 atcgtgtcacgttttcccaaaatcgtg-cacgattgagcaccctgaaaagccatgctcactgcct-gaaaatcgtgacacg 1735832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 7764172 - 7764124
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | ||||| |||||||||    
7764172 atcgtgtcacgttttcccaaaatcgtgtcacgattggacgccctgaaaa 7764124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 90
Target Start/End: Original strand, 8127110 - 8127186
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatc-atgctcactgcctagaaaatcgtga 90  Q
    ||||||||||| || |||||||||||| ||| | ||  ||||||||||  | |||||||||||||| ||||||||||    
8127110 atcgtgtcacactttcccaaaatcgtgacacgattgagcaccctgaaagcccatgctcactgcctaaaaaatcgtga 8127186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 92
Target Start/End: Original strand, 40845180 - 40845212
Alignment:
60 aaaatcatgctcactgcctagaaaatcgtgaca 92  Q
    ||||||||||||||||||||||||||| |||||    
40845180 aaaatcatgctcactgcctagaaaatcatgaca 40845212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 18)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 26363768 - 26363626
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||||||||||| | |||||||||| ||||  ||| |||||||||| |||||||||||| |||||||||||||||||||||    
26363768 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctaaaaacaatgttcactgcctaaaaaatcgtgacatggttgccaaatcgtgtcacga 26363669  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    ||||||||||||||||||||||||||| |||||||||||||||    
26363668 ttcttcactttctcaaaatccattttttagtcacatctcaaca 26363626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 144
Target Start/End: Complemental strand, 54882543 - 54882413
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaa-tcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| ||| ||||||||||||||  |||| |||||||| | ||||||||||||||||||    
54882543 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaccatgctcactgccttcaaaaatcgtgacatgattgccaaatcgtgtcacg 54882444  T
114 attcttcactttctcaaaatccatttttgag 144  Q
     |||||||||||||| |||  ||||||||||    
54882443 tttcttcactttctccaaaatcatttttgag 54882413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 9927908 - 9928012
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||||||| |||||||||||||||| | || |||||||| ||| |||| ||||||||||||||||||||| ||| |||  |||| |||||||||    
9927908 atcgtgtcacattttcccaaaatcgtgtcacgattgaacaccctgcaaaacatgttcactgcctagaaaatcgtgatacgcttgttaaattgtgtcacga 9928007  T
115 ttctt 119  Q
    |||||    
9928008 ttctt 9928012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 12745864 - 12745967
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| ||||||||| |||||| | |||||||||||  || || |||||||||||||||||||||| |||| |||| ||||||||||||||    
12745864 atcgtgtcacgttttcccaaaatcatgtcacgattggacaccctgccaaaca-gctcactgcctagaaaatcgtgtcacgcttgctaaatcgtgtcacga 12745962  T
115 ttctt 119  Q
    |||||    
12745963 ttctt 12745967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 12740001 - 12740089
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt 119  Q
    |||||||||||||| |   ||||||||||| ||| || ||||| ||||||||||||||||||||| |||| |||||||||||||||||||    
12740001 cccaaaatcgtgtcgcggttggacaccctgcaaaaca-gctcagtgcctagaaaatcgtgacacgtttgctaaatcgtgtcacgattctt 12740089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 12748207 - 12748295
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt 119  Q
    |||||||||||||| |   ||||||||||| ||| || ||||| ||||||||||||||||||||| |||| |||||||||||||||||||    
12748207 cccaaaatcgtgtcgcggttggacaccctgcaaaaca-gctcagtgcctagaaaatcgtgacacgtttgctaaatcgtgtcacgattctt 12748295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 81 - 157
Target Start/End: Original strand, 50263418 - 50263494
Alignment:
81 aaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    |||||||||||| | ||  |||||||||||||||||    |||||||||||||||||||||||||||||||||||||    
50263418 aaaatcgtgacatgcttagcaaatcgtgtcacgatttgcaactttctcaaaatccatttttgagtcacatctcaaca 50263494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 6655459 - 6655357
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||||||| |||||||||||||||| | ||||||||||| ||| ||||||||| || | | ||||||||||||||  |   |||||||||||||    
6655459 atcgtgtcacatttccccaaaatcgtgtcacgattggacaccctgcaaaacatgctcacggcattgcaaaatcgtgacacgcctatgaaatcgtgtcacg 6655360  T
114 att 116  Q
    |||    
6655359 att 6655357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 34 - 116
Target Start/End: Original strand, 18377838 - 18377920
Alignment:
34 aaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    |||||||||||||| || |||||| ||||| ||||||  ||||| ||||||| |||||||| ||||  |||||||||||||||    
18377838 aaatcgtgtcacaattgaacacccagaaaaacatgcttcctgccgagaaaattgtgacacgcttgcataatcgtgtcacgatt 18377920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 158
Target Start/End: Original strand, 50674577 - 50674654
Alignment:
81 aaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||||||||||||| |  ||||||||||||||| ||   ||||||| || ||||||||||||||||| ||||||||||    
50674577 aaaatcgtgacacgttacccaaatcgtgtcacgttttggcactttcacacaatccatttttgagtcatatctcaacaa 50674654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 93
Target Start/End: Complemental strand, 16628488 - 16628411
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacac 93  Q
    |||||||||| ||| |||||||||||| ||| | ||  ||||||| ||| |||||||||||||| ||||||||||||||    
16628488 atcgtgtcacgttttcccaaaatcgtgacacgattgagcaccctgcaaagcatgctcactgcct-gaaaatcgtgacac 16628411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 119
Target Start/End: Complemental strand, 3754733 - 3754630
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    ||||||||||||||    |||||||||| |||| || |||||||| ||| || ||||| || ||| |||||||||||| | |||  ||||||||||||||    
3754733 atcgtgtcacatttttttaaaatcgtgttacaattgtacaccctgcaaaaca-gctcattgtctaaaaaatcgtgacatgcttgttaaatcgtgtcacga 3754635  T
115 ttctt 119  Q
    |||||    
3754634 ttctt 3754630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 8653149 - 8653109
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcac 122  Q
    |||| ||||||||||||||||||| ||||||||||||||||    
8653149 aaattgtgacacggttgccaaatcatgtcacgattcttcac 8653109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 8664956 - 8664916
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcac 122  Q
    |||| ||||||||||||||||||| ||||||||||||||||    
8664956 aaattgtgacacggttgccaaatcatgtcacgattcttcac 8664916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 52095808 - 52095856
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | |||||||||||||||    
52095808 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgaaaa 52095856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 3778029 - 3778108
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||| ||| | ||  ||||||| ||| ||||||| |||| | |||||||||||||||    
3778029 atcgtgtcacgttttcccaaaatcgtgacacgattgagcaccctgcaaaccatgctcgctgcttggaaaatcgtgacacg 3778108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 118
Target Start/End: Original strand, 34570917 - 34570955
Alignment:
80 gaaaatcgtgacacggttgccaaatcgtgtcacgattct 118  Q
    ||||||||||||||| |||| ||||||||||||||||||    
34570917 gaaaatcgtgacacgcttgctaaatcgtgtcacgattct 34570955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 24968745 - 24968696
Alignment:
102 aatcgtgtcacgattcttcactttct-caaaatccatttttgagtcacat 150  Q
    |||||||||||||||||||||||| | |||| || |||||||||||||||    
24968745 aatcgtgtcacgattcttcactttatccaaactcaatttttgagtcacat 24968696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 21593169 - 21593058
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||| ||||||| | ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||    
21593169 atcgtgtcacgttttcccaaaattgtgtcacgattggacaccctgaaaaccatgctcactacctagaaaatcgtgacacggttgccaaatcatgtcacga 21593070  T
115 ttcttcactttc 126  Q
    ||||||||||||    
21593069 ttcttcactttc 21593058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 81 - 116
Target Start/End: Original strand, 33160847 - 33160882
Alignment:
81 aaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    |||||||||||||| |||||||||||||||||||||    
33160847 aaaatcgtgacacgcttgccaaatcgtgtcacgatt 33160882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 64
Target Start/End: Original strand, 9183457 - 9183506
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaat 64  Q
    |||||||||| ||| |||||||||||||||| | |||||||||| |||||    
9183457 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctaaaaat 9183506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 22)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 33 - 144
Target Start/End: Original strand, 34311285 - 34311396
Alignment:
33 aaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaa 132  Q
    ||||||||||||  | ||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||      
34311285 aaaatcgtgtcatgattggacaccctgcaaaccatgctcactgcctagaaaatcgtgacacgtttgccaaatcgtgtcacgattcttcactttctcaatc 34311384  T
133 tccatttttgag 144  Q
    | ||||||||||    
34311385 ttcatttttgag 34311396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 2389795 - 2389653
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||||||| | |||||||||||||| | |||||||||| |||| ||||||||||| ||||||||||||| |||||||   |||| |||||||||    
2389795 atcgtgtcacattttctcaaaatcgtgtcacgattggacaccctaaaaaccatgctcactgtctagaaaatcgtgccacggttcataaattgtgtcacga 2389696  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    || |  |||||  | ||| ||||||||||||||||||||||||    
2389695 ttatgaacttttcccaaaaccatttttgagtcacatctcaaca 2389653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 118
Target Start/End: Original strand, 47674390 - 47674494
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| |||| |||||||||||||| ||||||||||||| | |||| |||||||||||||    
47674390 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcactgcctggaaaatcgtgacatgcttgctaaatcgtgtcacg 47674489  T
114 attct 118  Q
    |||||    
47674490 attct 47674494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 118
Target Start/End: Original strand, 47676583 - 47676687
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| |||| |||||||||||||||||||||||||||||| |||| ||||| ||||| |    
47676583 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcactgcctagaaaatcgtgacacgcttgctaaatcatgtcatg 47676682  T
114 attct 118  Q
    |||||    
47676683 attct 47676687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 14070281 - 14070383
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||||||||||| | || |||||||||||| |||||||||||||| |||||||||| |||| |  | ||||||||||||||    
14070281 atcgtgtcacgttttcccaaaatcgtgtcacgattgaacaccctgaaaaccatgctcactgccttgaaaatcgtgccacgatgccaaaatcgtgtcacga 14070380  T
115 ttc 117  Q
    |||    
14070381 ttc 14070383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 14380309 - 14380411
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||||||||||| | || |||||||||||| |||||||||||||| |||||||||| |||| |  | ||||||||||||||    
14380309 atcgtgtcacgttttcccaaaatcgtgtcacgattgaacaccctgaaaaccatgctcactgccttgaaaatcgtgccacgatgccaaaatcgtgtcacga 14380408  T
115 ttc 117  Q
    |||    
14380409 ttc 14380411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 4585878 - 4585778
Alignment:
19 tgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattct 118  Q
    |||||| ||| |||||||| ||||||| | ||||||||||| ||| |||||||||||||||||||||||||||||  |||| |||| ||||||| |||||    
4585878 tgtcacgttttcccaaaatagtgtcacgattggacaccctgcaaaacatgctcactgcctagaaaatcgtgacacacttgctaaatagtgtcacaattct 4585779  T
119 t 119  Q
    |    
4585778 t 4585778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 27347630 - 27347543
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctgaaaatca-tgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgatt 116  Q
    |||||||||||||||| | ||| ||||||| ||| || |||||||||||||||||||||||||||| ||  |||||||||||||||||    
27347630 cccaaaatcgtgtcacgattgggcaccctgcaaaacagtgctcactgcctagaaaatcgtgacacgcttagcaaatcgtgtcacgatt 27347543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 32358504 - 32358580
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    ||||||| ||| ||||||||||| |||| | |||| |||||||||| ||||||||||||||||||||||||| ||||    
32358504 gtgtcacgttttcccaaaatcgtatcacgattggataccctgaaaaccatgctcactgcctagaaaatcgtgtcacg 32358580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 85 - 128
Target Start/End: Complemental strand, 48491250 - 48491207
Alignment:
85 tcgtgacacggttgccaaatcgtgtcacgattcttcactttctc 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
48491250 tcgtgacacggttgccaaatcgtgtcacgattcttcactttctc 48491207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 112
Target Start/End: Complemental strand, 18126349 - 18126268
Alignment:
31 ccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcac 112  Q
    ||||||||||| ||| | ||||||||||| |||| ||| |||||| ||||||||||| ||||||| ||||||| |||||||||    
18126349 ccaaaatcgtg-cacgattggacaccctgcaaaaccatactcactacctagaaaatcatgacacgtttgccaattcgtgtcac 18126268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 26417034 - 26416933
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcct-agaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||||||| |||||||||||||||||| ||||||| | ||||| ||||||| | || | |  ||||||||||||| ||   |||||||||||||    
26417034 atcgtgtcacatttccccaaaatcgtgtcacaattggacactcagaaaa-catgctctcggcataaccaaatcgtgacacgcttatgaaatcgtgtcacg 26416936  T
114 att 116  Q
    |||    
26416935 att 26416933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 158
Target Start/End: Complemental strand, 6570314 - 6570170
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    ||||||||||  || || ||||| ||||||||| ||||| | |  |||| ||||||||| |||  | ||||||||||||||||   ||||||||||||||    
6570314 atcgtgtcacgattgcctaaaattgtgtcacaattggaccctcaaaaaaccatgctcacggccctgcaaaatcgtgacacggtccacaaatcgtgtcacg 6570215  T
114 attcttcactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||    ||||| || ||| |||||||||||||| || |||||||    
6570214 atttggaactttttccaaaaccatttttgagtcaaatttcaacaa 6570170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 23554760 - 23554712
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | |||||||||||||||    
23554760 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgaaaa 23554712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 33332067 - 33331987
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatc-atgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| |||  ||||||||||| ||||| ||  |||||| |||| | |||||||||||||| ||||||||||||||    
33332067 atcgtgtcacgtttttccaaaatcgtgacacaattgagcaccctaaaaaaccatgctcactgcctaaaaaatcgtgacacg 33331987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 158
Target Start/End: Original strand, 4513066 - 4513104
Alignment:
120 cactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    ||||||||||| || ||||||||||||||||||||||||    
4513066 cactttctcaatattcatttttgagtcacatctcaacaa 4513104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 128
Target Start/End: Complemental strand, 48489084 - 48489039
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctc 128  Q
    ||||| |||||||||||||||| ||||||||| ||||||||||||||    
48489084 aaatcatgacacggttgccaaaacgtgtcacg-ttcttcactttctc 48489039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 89
Target Start/End: Original strand, 49092172 - 49092245
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtg 89  Q
    |||||||||||||| |||||||||||| ||| | ||  ||||||| ||| ||||||||||| || ||||||||||    
49092172 atcgtgtcacattttcccaaaatcgtgacacgattgagcaccctgcaaaccatgctcactgtct-gaaaatcgtg 49092245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 4509323 - 4509412
Alignment:
70 tcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt-cactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||| |||| |||||||||| |||| |  | |||||||||||||||||   |||||||||||  | |||||||||| |||||||||||||    
4509323 tcacggccttgaaaatcgtgtcacgatcccaaaatcgtgtcacgattccaacactttctcaattttcatttttgagccacatctcaacaa 4509412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 4511165 - 4511254
Alignment:
70 tcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt-cactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||| |||| |||||||||| |||| |  | |||||||||||||||||   |||||||||||  | |||||||||| |||||||||||||    
4511165 tcacggccttgaaaatcgtgtcacgatcccaaaatcgtgtcacgattccaacactttctcaattttcatttttgagccacatctcaacaa 4511254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 158
Target Start/End: Complemental strand, 6431513 - 6431424
Alignment:
70 tcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt-cactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||| |||| |||||||||| |||| |  | |||||||||||||||||   |||||||||||  | |||||||||| |||||||||||||    
6431513 tcacggccttgaaaatcgtgtcacgatcccaaaatcgtgtcacgattccaacactttctcaattttcatttttgagccacatctcaacaa 6431424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 6360577 - 6360621
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg 59  Q
    |||||||||| ||| |||||||||||||||||| ||| |||||||    
6360577 atcgtgtcacgtttccccaaaatcgtgtcacaattgggcaccctg 6360621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 13)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 15 - 158
Target Start/End: Complemental strand, 40146770 - 40146627
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||| ||||||||| |||||||||||||||| | ||||||||||||||| |||| |||||||||||||||||||| |||||||   | ||||||||||||    
40146770 atcgagtcacattttcccaaaatcgtgtcacgattggacaccctgaaaaccatgttcactgcctagaaaatcgtgccacggttcatagatcgtgtcacga 40146671  T
115 ttcttcactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    ||||  |||||  | ||| |||||||||||||||||||||||||    
40146670 ttctgaacttttcccaaaaccatttttgagtcacatctcaacaa 40146627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 115
Target Start/End: Original strand, 42428865 - 42428966
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| |||| |||||||||| ||||||||||||||||||| || | |||||||||||||    
42428865 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcacttcctagaaaatcgtgacacgcttactaaatcgtgtcacg 42428964  T
114 at 115  Q
    ||    
42428965 at 42428966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 119
Target Start/End: Complemental strand, 32636544 - 32636441
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||| ||| ||| |||||||||||||||| | |||||||| || ||| |||| ||||||||||| |||| |||||||| |||||||||||||||||||    
32636544 atcgtgccacgttttcccaaaatcgtgtcacgattggacaccttgcaaaacatgttcactgcctag-aaatggtgacacgcttgccaaatcgtgtcacga 32636446  T
115 ttctt 119  Q
    |||||    
32636445 ttctt 32636441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 42426685 - 42426783
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgat 115  Q
    ||||||| ||| |||||||||||||||| | ||||||||||| |||| ||||||||||||| |||||||| ||||||| |||| ||||||||| |||||    
42426685 gtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcactgcccagaaaatcatgacacgcttgctaaatcgtgtgacgat 42426783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 213065 - 212986
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||||||| | ||||| ||||| ||| |||||||||| |||||||||||||| ||||    
213065 atcgtgtcacgttttcccaaaatcgtgtcacgattggacgccctgcaaaccatgctcactacctagaaaatcgtgtcacg 212986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 5057549 - 5057450
Alignment:
18 gtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattc 117  Q
    ||||||| |||  ||||||||||||||| | |||||||||||||||  ||||||| ||||||||||||||||  ||| |  | |||||||||||||||||    
5057549 gtgtcacgttttaccaaaatcgtgtcacgattggacaccctgaaaactatgctcattgcctagaaaatcgtgctacgatgccaaaatcgtgtcacgattc 5057450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 117
Target Start/End: Complemental strand, 37438866 - 37438764
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| ||||||||| |||||| | ||||||| ||||||| |||||||||||||| |||||||||  |||| |  | ||||| ||||||||    
37438866 atcgtgtcacgttttcccaaaatcatgtcacgattggacactctgaaaaccatgctcactgccttgaaaatcgtaccacgatgccaaaatcatgtcacga 37438767  T
115 ttc 117  Q
    |||    
37438766 ttc 37438764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 12083794 - 12083693
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||||||| ||| |||||||  ||| ||||| ||  ||||||| ||| |||||||||||||| | ||||||||||||| |    ||||||||||||||    
12083794 atcgtgtcacgttttcccaaaactgtgacacaattgagcaccctgtaaaccatgctcactgcctgggaaatcgtgacacgttgatgaaatcgtgtcacga 12083695  T
115 tt 116  Q
    ||    
12083694 tt 12083693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 16651069 - 16651174
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcat-gctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||  | ||   |||||||||| ||| |||||||||||   |||||||| |||| |||| |||||||| ||||    
16651069 atcgtgtcacgttttcccaaaatcgtgtcatgattgagtaccctgaaaaacattgctcactgcctcagaaatcgtgtcacgtttgctaaatcgtgacacg 16651168  T
114 attctt 119  Q
    ||||||    
16651169 attctt 16651174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 42310463 - 42310512
Alignment:
102 aatcgtgtcacgattcttcactttct-caaaatccatttttgagtcacat 150  Q
    |||||||||||||||||||||||||| |||| || |||||||||||||||    
42310463 aatcgtgtcacgattcttcactttctccaaactcaatttttgagtcacat 42310512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 11916588 - 11916509
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||| ||| | ||  ||||||| ||| ||  |||||||||| |||||||||||||||    
11916588 atcgtgtcacgttttcccaaaatcgtgacacgattgagcaccctgcaaaccacactcactgcctggaaaatcgtgacacg 11916509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 147
Target Start/End: Complemental strand, 42926548 - 42926502
Alignment:
102 aatcgtgtcacgattcttcactttctcaaaatc-catttttgagtca 147  Q
    |||||||||||||||||||||||||||||| ||  ||||||||||||    
42926548 aatcgtgtcacgattcttcactttctcaaattcaaatttttgagtca 42926502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 130
Target Start/End: Complemental strand, 212998 - 212969
Alignment:
101 aaatcgtgtcacgattcttcactttctcaa 130  Q
    ||||||||||||||||||||||||||||||    
212998 aaatcgtgtcacgattcttcactttctcaa 212969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 15)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 15212507 - 15212405
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| |||| |||||||||||||||||||||||||||||| ||||||  |||||||| |    
15212507 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgcaaaaccatgctcactgcctagaaaatcgtgacacgtttgccacttcgtgtcatg 15212408  T
114 att 116  Q
    |||    
15212407 att 15212405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 30 - 118
Target Start/End: Complemental strand, 33351877 - 33351788
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctg-aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattct 118  Q
    |||||||||||||||| | ||||||||||| |||| |||| |||||||||| |||||||||||||| |||| ||||||||||||||||||    
33351877 cccaaaatcgtgtcacgattggacaccctgcaaaaccatgttcactgcctaaaaaatcgtgacacgcttgctaaatcgtgtcacgattct 33351788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 117
Target Start/End: Complemental strand, 11383509 - 11383405
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag--aaaatcgtgacacggttgccaaatcgtgtcac 112  Q
    |||||||||| ||| |||||||||||||||||| |||||||||| |||| ||||||||||| ||||  ||||||||| |||| |  | ||||||||||||    
11383509 atcgtgtcacgttttcccaaaatcgtgtcacaattggacaccctaaaaaccatgctcactgtctagaaaaaatcgtgccacgatgccaaaatcgtgtcac 11383410  T
113 gattc 117  Q
    |||||    
11383409 gattc 11383405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 22976037 - 22975958
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||||||| ||||| ||||||||| ||||||||| ||||    
22976037 atcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctgaaaaccatgcccactgcctaaaaaatcgtgtcacg 22975958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 4731364 - 4731266
Alignment:
30 cccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctaga-aaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctc 128  Q
    |||||||||||||||| | ||||||||||| ||| || ||||||  | | |  ||||||||||||||||| |||||||||||||||||||||||||||||    
4731364 cccaaaatcgtgtcacgattggacaccctgtaaaaca-gctcacgacattgcgaaatcgtgacacggttgtcaaatcgtgtcacgattcttcactttctc 4731266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 15 - 127
Target Start/End: Complemental strand, 4733546 - 4733434
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctaga-aaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | || |||||||| ||| || ||||||  | | |  |||||||||||| ||||||||||||||||| |    
4733546 atcgtgtcacgttttcccaaaatcgtgtcacgattgaacaccctggaaaaca-gctcacgacattgcgaaatcgtgacacagttgccaaatcgtgtcatg 4733448  T
114 attcttcactttct 127  Q
    ||||||||||||||    
4733447 attcttcactttct 4733434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 30143063 - 30143005
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcac 73  Q
    |||||||||||||| |||||||||||||||| | ||||||||||| ||| |||||||||    
30143063 atcgtgtcacattttcccaaaatcgtgtcacgattggacaccctgcaaaacatgctcac 30143005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 158
Target Start/End: Original strand, 40220132 - 40220209
Alignment:
81 aaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaatccatttttgagtcacatctcaacaa 158  Q
    |||||||||||||| |  ||||||||||||||| ||   ||||||| || ||||||||||||||||| ||||||||||    
40220132 aaaatcgtgacacgttacccaaatcgtgtcacgttttggcactttcgcacaatccatttttgagtcatatctcaacaa 40220209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 42435656 - 42435736
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacg 94  Q
    |||||||||| ||| |||||||||||||||| | ||||||||||| ||| ||||||||| || | | ||||||||||||||    
42435656 atcgtgtcacgtttccccaaaatcgtgtcacgattggacaccctgcaaaacatgctcacggcattgcaaaatcgtgacacg 42435736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 3051626 - 3051700
Alignment:
60 aaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattcttcactttctcaaaatc 134  Q
    |||| ||||||||| | ||||||||||||||||||  | ||||||| ||||||||||||  ||||||||| ||||    
3051626 aaaaccatgctcacggtctagaaaatcgtgacacgcctaccaaatcatgtcacgattctgaactttctcagaatc 3051700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 43036144 - 43036086
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcac 73  Q
    |||||||||| |||  ||||||||||||||| | ||||||||||| ||| |||||||||    
43036144 atcgtgtcacgtttttccaaaatcgtgtcacgattggacaccctgcaaaacatgctcac 43036086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 12703086 - 12703134
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    |||||||||| ||| |||||||||||||||| | ||||||| |||||||    
12703086 atcgtgtcacgttttcccaaaatcgtgtcacgattggacactctgaaaa 12703134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 27811019 - 27810975
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctg 59  Q
    |||||||||||||| | |||||||||||||| | |||||||||||    
27811019 atcgtgtcacattttctcaaaatcgtgtcacgattggacaccctg 27810975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 31217977 - 31217929
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    ||||||||||  || |||||||||||||||||| ||||| |||||||||    
31217977 atcgtgtcacgatttcccaaaatcgtgtcacaattggacgccctgaaaa 31217929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 42497935 - 42497887
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaa 63  Q
    ||||||||||| || |||||||||||||||| | ||||| |||||||||    
42497935 atcgtgtcacaatttcccaaaatcgtgtcacgattggacgccctgaaaa 42497887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 31 - 144
Target Start/End: Complemental strand, 193099 - 192985
Alignment:
31 ccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaa-tcgtgacacggttgccaaatcgtgtcacgattcttcactttctca 129  Q
    ||||||| ||||||  | ||||||||||| ||| ||||||||||||||  |||| |||||||||| |||||||||| ||||||| ||||||||||||||     
193099 ccaaaattgtgtcatgattggacaccctgcaaaccatgctcactgccttcaaaaatcgtgacacgattgccaaatcatgtcacgtttcttcactttctcc 193000  T
130 aaatccatttttgag 144  Q
    |||  ||||||||||    
192999 aaaatcatttttgag 192985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 28220674 - 28220776
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatca-tgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||| ||||||| ||| || ||||||||||| |||||||| ||||||| ||||||| ||||||||||    
28220674 atcgtgtcacgttttcccaaaatcgtgtcacgattgggcaccctgcaaaacagtgctcactgccaagaaaatcatgacacgtttgccaattcgtgtcacg 28220773  T
114 att 116  Q
    |||    
28220774 att 28220776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 33 - 119
Target Start/End: Original strand, 30476892 - 30476978
Alignment:
33 aaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattctt 119  Q
    ||||||||||||| | | ||||||||| ||| ||||| |||||||||||||||||||||||| || | |||||||||||||||||||    
30476892 aaaatcgtgtcacgattagacaccctgcaaaacatgcccactgcctagaaaatcgtgacacgcttactaaatcgtgtcacgattctt 30476978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 28223869 - 28223971
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatca-tgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||| ||||||| ||| || | ||||||||| |||||||| ||||||| ||||||| ||||||||||    
28223869 atcgtgtcacgttttcccaaaatcgtgtcacgattgggcaccctgcaaaacagttctcactgccaagaaaatcatgacacgtttgccaattcgtgtcacg 28223968  T
114 att 116  Q
    |||    
28223969 att 28223971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 82 - 126
Target Start/End: Original strand, 42298593 - 42298637
Alignment:
82 aaatcgtgacacggttgccaaatcgtgtcacgattcttcactttc 126  Q
    |||||||||||||||||||||||||||||| ||||||||||||||    
42298593 aaatcgtgacacggttgccaaatcgtgtcatgattcttcactttc 42298637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 29135753 - 29135698
Alignment:
102 aatcgtgtcacgattcttcactttctcaaaatccatttttgagtcacatctcaaca 157  Q
    |||||||||||||||||  |||||  | ||| ||||||||||||||||||||||||    
29135753 aatcgtgtcacgattctgaacttttcccaaaaccatttttgagtcacatctcaaca 29135698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 44454880 - 44454779
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||| | ||||||| | ||||| ||||||| | || |||  ||||||||||||| ||   |||||||||||||    
44454880 atcgtgtcacgtttccccaaaatcgtgtcacgattggacactcagaaaa-catgctctcggcatagccaaatcgtgacacgcttatgaaatcgtgtcacg 44454782  T
114 att 116  Q
    |||    
44454781 att 44454779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0466 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0466
Description:

Target: scaffold0466; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 6833 - 6749
Alignment:
33 aaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacgattc 117  Q
    ||||||||||||| | ||||||||||| ||| ||||||||||||||||||||||||| |||| |  | |||||||||||||||||    
6833 aaaatcgtgtcacgattggacaccctgcaaaccatgctcactgcctagaaaatcgtgccacgatgccaaaatcgtgtcacgattc 6749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 80948 - 81050
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctagaaaatcgtgacacggttgccaaatcgtgtcacga 114  Q
    |||||| ||| ||| |||||||||||||||| | |||| ||||||||||  |||||||||||||||||||||||  |||| |  | ||||||||||||||    
80948 atcgtgccacgttttcccaaaatcgtgtcacgattggataccctgaaaacaatgctcactgcctagaaaatcgtaccacgatgccaaaatcgtgtcacga 81047  T
115 ttc 117  Q
    |||    
81048 ttc 81050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0286 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0286
Description:

Target: scaffold0286; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 11061 - 10959
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||||||| |||||||||||||||| | ||||||||||| ||| ||||||||| || | | ||||||||||||||  |   |||||||||||||    
11061 atcgtgtcacatttccccaaaatcgtgtcacgattggacaccctgcaaaacatgctcacggcattgcaaaatcgtgacacgcctatgaaatcgtgtcacg 10962  T
114 att 116  Q
    |||    
10961 att 10959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0066 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 115
Target Start/End: Original strand, 20862 - 20963
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctcactgcctag-aaaatcgtgacacggttgccaaatcgtgtcacg 113  Q
    |||||||||| ||| |||||||||||||||  | ||||||||||| ||| |||||||||  | | | |||||||||||||| ||  ||||||||||||||    
20862 atcgtgtcacgttttcccaaaatcgtgtcatgattggacaccctgcaaaacatgctcacgacattgcaaaatcgtgacacgcttcacaaatcgtgtcacg 20961  T
114 at 115  Q
    ||    
20962 at 20963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 17711 - 17767
Alignment:
15 atcgtgtcacatttacccaaaatcgtgtcacaaatggacaccctgaaaatcatgctc 71  Q
    |||||||||| ||| ||||||||||||||||   ||||||||||| ||| |||||||    
17711 atcgtgtcacgttttcccaaaatcgtgtcacggttggacaccctgcaaaacatgctc 17767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University