View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_151 (Length: 249)
Name: NF6819A_low_151
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_151 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 32268068 - 32268287
Alignment:
| Q |
20 |
aaattcaacaaagtagcaactttttcgtccatctctatttgtaaaacaaccagcattaaaaggttattattctcttctttcaaaatacgagatttagttg |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268068 |
aaattcaacaaagttgcaactttttcgtccatctctatttgtaaaacaaccagcattaaaaggttattattctcttctttcaaaatacgagatttagttg |
32268167 |
T |
|
| Q |
120 |
aagtggttaatgtgttttattttaagacagattgttcagaacagcacacgttcaattcttcgccgaaaaaataatttttcaatcattattattgaactat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32268168 |
aagtggttaatgtgttttattttaagacaaattgttcagaacaacacacgttcaattcttcgccgaaaaaatcatttttcaatcattattattgaactat |
32268267 |
T |
|
| Q |
220 |
agattaccgaatcatattct |
239 |
Q |
| |
|
|||||||| |||||| |||| |
|
|
| T |
32268268 |
agattaccaaatcattttct |
32268287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University