View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_161 (Length: 244)

Name: NF6819A_low_161
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_161
NF6819A_low_161
[»] chr3 (2 HSPs)
chr3 (1-91)||(2523621-2523711)
chr3 (157-223)||(2523489-2523555)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 2523711 - 2523621
Alignment:
1 taaatttcattttttggaaaatttgataagtttggcttaaggtccccttttaaaaaatgatatgtttttgttcctcttttaaataggatag 91  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2523711 taaatttcattttttggaaaatttgataagtttggcttaaggtccccttttaaaaaattatatgtttttgttcctcttttaaataggatag 2523621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 2523555 - 2523489
Alignment:
157 catgtaattaaaagataagttaagatactagaaattgtacctattgatatggcatttgtgcttctct 223  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2523555 catgtaatgaaaagataagttaagatactagaaattgtacctattgatatggcatttgtgcttctct 2523489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University