View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_161 (Length: 244)
Name: NF6819A_low_161
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_161 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 2523711 - 2523621
Alignment:
| Q |
1 |
taaatttcattttttggaaaatttgataagtttggcttaaggtccccttttaaaaaatgatatgtttttgttcctcttttaaataggatag |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2523711 |
taaatttcattttttggaaaatttgataagtttggcttaaggtccccttttaaaaaattatatgtttttgttcctcttttaaataggatag |
2523621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 2523555 - 2523489
Alignment:
| Q |
157 |
catgtaattaaaagataagttaagatactagaaattgtacctattgatatggcatttgtgcttctct |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2523555 |
catgtaatgaaaagataagttaagatactagaaattgtacctattgatatggcatttgtgcttctct |
2523489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University