View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_170 (Length: 241)
Name: NF6819A_low_170
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_170 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35629273 - 35629053
Alignment:
| Q |
1 |
gaccctataacaagaccaaatgatgatatggttgcggcaattcacactagcattgatggacgtttcgcttttataaaagcgggtgaaccatgctggactt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35629273 |
gaccctataacaagaccaaatgattatatggttgcggcaattcacactagcattcatggacgtttcgcttttataaaagcgggtgaaccatgctggactt |
35629174 |
T |
|
| Q |
101 |
atgtatatagctcgagctggcgtcattcctttcaggatattatgttctatggaggtttagtttatgttgcgagtaaatatcacggtataatgtcttttaa |
200 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |||| ||||||||||| |||||||||||||||||| |||||||||||| |||||| | |||||||| |
|
|
| T |
35629173 |
atgtatgtagctcgagctggcttcattcctttatggatgttatgttctatagaggtttagtttatgttgggagtaaatatcagggtatagtatcttttaa |
35629074 |
T |
|
| Q |
201 |
tcttggtgataagaggataac |
221 |
Q |
| |
|
||||||| |||| |||||||| |
|
|
| T |
35629073 |
tcttggtcataaaaggataac |
35629053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University