View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_177 (Length: 238)
Name: NF6819A_low_177
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_177 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 3429499 - 3429300
Alignment:
| Q |
19 |
gaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatcccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429499 |
gaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaatcccat |
3429400 |
T |
|
| Q |
119 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccatgatgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3429399 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatgg |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 3426020 - 3425822
Alignment:
| Q |
19 |
gaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatcccat |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
3426020 |
gaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgccat |
3425921 |
T |
|
| Q |
119 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccatgatg |
217 |
Q |
| |
|
||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| ||||||| |||| |
|
|
| T |
3425920 |
atctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University