View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_178 (Length: 237)
Name: NF6819A_low_178
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_178 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 60 - 121
Target Start/End: Complemental strand, 10647538 - 10647477
Alignment:
| Q |
60 |
caaatgctggtgcaagcacaaaaattcgaatcgtgtgaacattgcaaaatcaaaataatgtt |
121 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10647538 |
caaatgttggtttaagcacaaaaattcgaatcgtgtgaacattacaaaatcaaaataatgtt |
10647477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 188
Target Start/End: Complemental strand, 10647444 - 10647377
Alignment:
| Q |
122 |
ataagttgcgaacttaacaaaa-gtacacttaagaactagaagaaatcttcaaaagtcatttttaata |
188 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||| || ||||||| ||||| | ||||||||||||||| |
|
|
| T |
10647444 |
ataagttgtgaacttaacaaaaagtatacttaaaaattagaagagatctttagaagtcatttttaata |
10647377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University