View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_179 (Length: 236)

Name: NF6819A_low_179
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_179
NF6819A_low_179
[»] chr2 (1 HSPs)
chr2 (1-230)||(35449823-35450052)
[»] chr4 (1 HSPs)
chr4 (1-66)||(21010633-21010698)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 35449823 - 35450052
Alignment:
1 gaaagagatgaagcacaagaaaaatgtgaaagacttctcttggaaaagctagttttccatcaacaacaaaatgctccactttccggagtttcaagcattg 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
35449823 gaaagagatgaagcacaagaaaaatgtcaaagacttctcttggaaaagctagttttccatcaacaacaaaatgatccactttccggagtttcaagcattg 35449922  T
101 aagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcatcagattgtgaagaaagcattgtttcttcaccaattattga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
35449923 aagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcttcagattgtgaagaaagcattgtttcttcaccaattattga 35450022  T
201 tcaatcaatgattgaagtactaacaccaaa 230  Q
    ||||||||||||||||||||||||||||||    
35450023 tcaatcaatgattgaagtactaacaccaaa 35450052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 21010698 - 21010633
Alignment:
1 gaaagagatgaagcacaagaaaaatgtgaaagacttctcttggaaaagctagttttccatcaacaa 66  Q
    ||||||||||||||||||||||||||  |||||||| |||| |||||| || ||||||| ||||||    
21010698 gaaagagatgaagcacaagaaaaatgccaaagacttttcttagaaaagttacttttccaacaacaa 21010633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University