View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_196 (Length: 230)
Name: NF6819A_low_196
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_196 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 71 - 220
Target Start/End: Original strand, 29052414 - 29052561
Alignment:
| Q |
71 |
atatggcaaagaatctttctaaataataacacaaagattccaaaacacacacacttctttcactataattgttcattgnnnnnnnnnnatctttccatca |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
29052414 |
atatggcaaagaatctttctaaataataacacaaagattccaaaacacacacacttctttcactataattgttcgttg--ttttttttatctttccatca |
29052511 |
T |
 |
| Q |
171 |
agaaatgaatttgaatcactcttgtggtttttctttaaccaaacatacaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052512 |
agaaatgaatttgaatcactcttgtggtttttctttaaccaaacatacaa |
29052561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University