View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_209 (Length: 229)
Name: NF6819A_low_209
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_209 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 45726367 - 45726139
Alignment:
| Q |
1 |
tattataaataatacataccttgtgtcgtgctgcaagtgcttctctgcatgcagtattgtacatgtccatcgtttgttttaactcaagctgcagcctccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45726367 |
tattataaataatacataccttgtgttgtgctgcaagtgcttctctgcacgcagtattgtacatgtccatcgtttgttttaactcaagctgcagcctccg |
45726268 |
T |
 |
| Q |
101 |
catatcagcttctgtttcatcctaagtggtttagcaaaaggaagtggataccattagtggtcgggtactacttgtttctacatgttaattcgaaagtgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45726267 |
catatcagcttctgtttcatcctaagtggtttagcaaaaggaagtggatacaattagtggtcgggtactacttgtttctacatgttaattcgaaagtgca |
45726168 |
T |
 |
| Q |
201 |
ttgctcaccatgtttgaatatgaacatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45726167 |
atgctcaccatgtttgaatatgaacatga |
45726139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University