View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_223 (Length: 224)
Name: NF6819A_low_223
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_223 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 34683212 - 34683397
Alignment:
| Q |
21 |
tcatgaagattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683212 |
tcatgaagattatgagcagaacctctataaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaa |
34683311 |
T |
|
| Q |
121 |
caaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683312 |
caaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
34683397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 25 - 201
Target Start/End: Original strand, 34699435 - 34699611
Alignment:
| Q |
25 |
gaagattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaacaaa |
124 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||| ||||||||| | |||| |||||||| | ||| |||||| || || |||| ||| ||||| ||| |
|
|
| T |
34699435 |
gaagattatgagcacaacatcaatgaaagtgggagccaactctgcgagtgtcttaagagagctatcaattacaatcaataatatgacaaagtcaaagaaa |
34699534 |
T |
|
| Q |
125 |
cttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacaca |
201 |
Q |
| |
|
||||||| | | |||| ||||||||||| ||| | | |||||| || |||||||||||||| ||| |||||||||| |
|
|
| T |
34699535 |
cttgatagtttggtcaaagagatgaatattgctacacaagagctacaaaatttattaaaatcatattcaaacacaca |
34699611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University