View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_229 (Length: 222)
Name: NF6819A_low_229
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_229 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 34142474 - 34142580
Alignment:
| Q |
1 |
gcagtttcaaagtgacttttaatatcttgattaatctctcccttgataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142474 |
gcagtttcaaagtgacttttaatatcttgattaatctctcccttaataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaa |
34142573 |
T |
 |
| Q |
101 |
tccagta |
107 |
Q |
| |
|
||||||| |
|
|
| T |
34142574 |
tccagta |
34142580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University