View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_232 (Length: 222)
Name: NF6819A_low_232
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_232 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 38807017 - 38807197
Alignment:
| Q |
20 |
acttttagcatatcttgttcttggaaagaattcaaacaaacaacacaacccttcacactttgatgattatcatcatcaccttctccttttgtgaattgaa |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38807017 |
acttttagcatatcatgttcttggaaagaattcaaacaaacaacacaaccctttacactttgatgattatcatcatcaccttctccttttgtgaattgaa |
38807116 |
T |
|
| Q |
120 |
atgttggtattccttggatgacggattcatcgacgccgcgggtccaaatccttggagagaatgctatgaagggttcttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38807117 |
atgttggtattccttggatgacggattcatcgacgccgcgagtccaaatccttggagagaatgctatgaagggttcttcat |
38807197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University