View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_247 (Length: 213)
Name: NF6819A_low_247
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_247 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 143 - 213
Target Start/End: Complemental strand, 10368546 - 10368476
Alignment:
| Q |
143 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368546 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaa |
10368476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 10368662 - 10368608
Alignment:
| Q |
27 |
actgagatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368662 |
actgagatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
10368608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 72
Target Start/End: Original strand, 36116774 - 36116814
Alignment:
| Q |
32 |
gatgaaggagaagaagaagaatggagttcaaagattcagat |
72 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36116774 |
gatgaaggagaagaagaataatggagttcaaagattcagat |
36116814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University