View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_249 (Length: 211)
Name: NF6819A_low_249
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_249 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 63 - 191
Target Start/End: Complemental strand, 3098919 - 3098791
Alignment:
| Q |
63 |
tgggtctctatggtaacaaaagtagccgaaaggaatgcaatgcatgaagagggattgtgaccgttgatgaatgtagtggtgggccatgtatgacatactg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098919 |
tgggtctctatggtaacaaaagtagccgaaaggaatgcaatgcatgaagagggattgtgaccgttgatgaatgtagtggtgggccatgtatgacatactg |
3098820 |
T |
 |
| Q |
163 |
aatggtggtgattgagttgtgagtgtaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3098819 |
aatggtggtgattgagttgtgagtgtaat |
3098791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University