View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_250 (Length: 211)
Name: NF6819A_low_250
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_250 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 211
Target Start/End: Original strand, 422889 - 423100
Alignment:
| Q |
3 |
agcattctaaatcaaactttagacttcaaaagttatagaagacacacttgtatgtaccttagcctgtatgtgtcagtgagtacaaaaggaatgcaataat |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
422889 |
agcattctaaataaaactttagacttcaaaagttatagaagacacacttgtatgtaccttagcttgtatgtgtcagtgagtacaaaaggaatgcaataat |
422988 |
T |
 |
| Q |
103 |
gaaaatggaaatagag---acaagttaatatagatatatgaaactaaccaattcttagaatcgtcaacatttgcaagaaaggaacccaatttgtcttccc |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
422989 |
gaaaatggaaatagagacaacaagttaatatagatatatgaaactaaccaattcttagaatcatcaacatttgcaagaaaggaacccaatttgtcttccc |
423088 |
T |
 |
| Q |
200 |
tttctttcttct |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
423089 |
tttctttcttct |
423100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University