View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_253 (Length: 209)

Name: NF6819A_low_253
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_253
NF6819A_low_253
[»] chr4 (1 HSPs)
chr4 (35-103)||(32265888-32265956)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 35 - 103
Target Start/End: Original strand, 32265888 - 32265956
Alignment:
35 atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttataacaaattggacattcata 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||    
32265888 atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttgtagcaaattggacattcata 32265956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University