View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6819A_low_254 (Length: 209)

Name: NF6819A_low_254
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6819A_low_254
NF6819A_low_254
[»] chr4 (1 HSPs)
chr4 (11-181)||(26453622-26453790)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 11 - 181
Target Start/End: Complemental strand, 26453790 - 26453622
Alignment:
11 gacatcatcactgacccaacaataaatttgtaaacaaattaaaagatgataaatgtgcaagacccttctctaatatttttgattgactcatatactagaa 110  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
26453790 gacaacatcactgacccaacaataaatttgtaaacaaatgaaaagatgataaatgtgcaagacccttctctaatattt--gattgactcatatactagaa 26453693  T
111 aaactatcaaatcaaatcaaactaggaaacaatctcaactgggtacctatcaatgcaatcttcccatggac 181  Q
    |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
26453692 aaactatcaaatcaaatcaaactaagaaacaatctcaactggatacctatcaatgcaatcttcccatggac 26453622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University