View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_254 (Length: 209)
Name: NF6819A_low_254
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_254 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 11 - 181
Target Start/End: Complemental strand, 26453790 - 26453622
Alignment:
| Q |
11 |
gacatcatcactgacccaacaataaatttgtaaacaaattaaaagatgataaatgtgcaagacccttctctaatatttttgattgactcatatactagaa |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26453790 |
gacaacatcactgacccaacaataaatttgtaaacaaatgaaaagatgataaatgtgcaagacccttctctaatattt--gattgactcatatactagaa |
26453693 |
T |
 |
| Q |
111 |
aaactatcaaatcaaatcaaactaggaaacaatctcaactgggtacctatcaatgcaatcttcccatggac |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26453692 |
aaactatcaaatcaaatcaaactaagaaacaatctcaactggatacctatcaatgcaatcttcccatggac |
26453622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University