View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_259 (Length: 207)
Name: NF6819A_low_259
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_259 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 32471918 - 32472086
Alignment:
| Q |
19 |
tcactatctttcaaataccctaacataacacaaccacctctcacaacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggaccca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32471918 |
tcactatctttcaaataccctaacataacacaaccacctctcataacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggaccca |
32472017 |
T |
|
| Q |
119 |
ccacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcg |
187 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472018 |
ctacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcg |
32472086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 32464945 - 32464839
Alignment:
| Q |
24 |
atctttcaaataccctaacataacacaaccacctctcacaacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggacccaccaca |
123 |
Q |
| |
|
|||||| ||||| || | |||||||||| ||||| | ||||| | |||||||| |||| |||||||| ||||||||||||||| | || || |||||| |
|
|
| T |
32464945 |
atcttttaaataaccaagcataacacaagcaccttttacaacgatttcaccaaccgttacaccatcattctttacactttcaccagtgggtccgaccaca |
32464846 |
T |
|
| Q |
124 |
tcaacct |
130 |
Q |
| |
|
||||||| |
|
|
| T |
32464845 |
tcaacct |
32464839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 130
Target Start/End: Original strand, 32456190 - 32456296
Alignment:
| Q |
24 |
atctttcaaataccctaacataacacaaccacctctcacaacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggacccaccaca |
123 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||| | ||||| | ||||||| ||| |||||||| || |||||||||||| | || ||||||||| |
|
|
| T |
32456190 |
atctttaaaataacctaacataacacatgcaccttttacaacgatctcaccaacggttacaccatcattcttcacactttcaccagtgggtcccaccaca |
32456289 |
T |
|
| Q |
124 |
tcaacct |
130 |
Q |
| |
|
||||||| |
|
|
| T |
32456290 |
tcaacct |
32456296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University